Description :
From Genome Similarity Track
Location :
Scaffold_34:30689- 81283
Transcript NameFunction/comments
Phyta_totarag1694hypothetical protein
Phyta_totarag1695hypothetical protein
Phyta_totarag1696hypothetical protein PHYSODRAFT_309023
Phyta_totarag1697conserved hypothetical protein
Phyta_totarag1698hypothetical protein PHYSODRAFT_554380
Phyta_totarag1699hypothetical protein PHYSODRAFT_554382
Phyta_totarag1700hypothetical protein PHYSODRAFT_309027
Phyta_totarag1701pyruvate dehydrogenase E1 alpha subunit
Phyta_totarag1702hypothetical protein PHYSODRAFT_554387
Phyta_totarag1703hypothetical protein
Phyta_totarag1704hypothetical protein
Phyta_totarag1705hypothetical protein PHYSODRAFT_309032

Sequence
50594 bases(100 bases per row)
CGCTCGCCTGTTCGTCTGTCCGTCGAGCCGAAGCTGAAAAACTTCAGCCTGCCAAAGCTCACAGAGCTGTTAATTGATCGAGaaactcgtgctgctgcct
ctaCACATAAATCCTGGGACGAAGCGCACAAAATTGAAGTACTCGTCGGAAGCAAGTGTGTCGGACGTGTGAGCGCTGCCTCACGGAATATCCCACCGTC
GATTCGTTCATGCCTGCGAGCCTCTGCAAACGTGTCAGTACGACGAGAGCGATTATACGACTTGCTTCACCGAGATTATGATGAGCTCAGCAAGCGCTAC
ACGCAGTAAACGACGCACCGGCGAACGGCGACTTGAACACTTCGACAGAATTGAGGAGAGGTTGGTCATTGCATTGGAAAGAAGGCGTCGTCTGTCAGCC
CTTCGAAGATATTTACGTTGCTGTCACCATACAAAGCTGAATCTGAAGACAAACTCATGGGCCCCGCTCCTGTTTGCTGTGGTGGGTGTTGAGGAAGCTG
ACTTTGTTGTTGGAAAGGTTGAGGGGTAGGCTGGAACTGATGTGTCTGCAATGACTGCGGCATCATACTTtgtgacgacgacgtcggcaTACCAACGCCT
GCTCCATATCCAAAATTGTTCGGCATCATTGATGCACCTTGCGCTCCAAAATTGGCCCCATTCATGGATCCCATCAtctggtgttgttgttgctgcatgg
GCATGCCCGCCATACCAGCCATGGGGAACCCAGATGGTCCGAAGCTTGTATCGGGGGTAAATCCAAGTGGGGTGATAAACGGATCCACAGGAAAGTTGGT
AGCGCTActattgttgttgttgctgccgtaCATATTCCCACCTCCCGAGGATGCCAGGTTCATGGGCATCGGCATTGGCAtaaattgctgctgttgggAG
TTCATCATGCCGCCGCCCATCATGTAGTTCTGCTGGTTCATAAATCCAGCGGACGAGCTAGGAGGCCCACTGGTGGAGGTCATGTACGCGTTTGGCGCGA
ATGTCTGCACCCCTGAGCTCATCGCGTATCCATGAGTCGACGTCGTAACACCAGAAACAGCCATCGATGTGGTTGAAGTGAATCCAGCCGACGTCTGCAT
CGGATTCATTTGTCCCGTCGGGAAGAACATACTCGAACTCGTAGACGCGAATCCAGCCGTAGGCATCGGAGGCTCAGGGAACATAGTTGGCGGCGTTGGT
ACAACCATATTCGGCATCGCCATGGACAGCGAAGTCGACACCGTCGACGCAGGTCCCATCGACATCGATGTCATCATAGCCATCGGATTACTGCTAGTCA
TCTTCGAAACCTGTGGCGGCGCGTATGCCTGCTGAGGGGCAGCATGAGTCGGTTGGTGTTGAACCTGTGGGGCCGCAGCACTCGGAGCTGCCAGAGTCGA
ATACTGCGACGTCCCTGCTTGTCTCTGAGCCGTTGCAGAGGGAGAAACCCTCTGCCCCCCAGTTTTctcatcttcttgagcgatCTGCTTGTCCGCCAAC
GAggccagcacctccagccTGGCTCCAACCTGCTGGCGGTAGGTTACACACCTCCGCACCCACTCTTTGTGCTGCGTAGGGTTCGTCTTGGCAGCTAAAA
GAACAATAAATAACAAAACACACATAATTCAACAAATAAAGTTTagtaaaaataaaaaataaaaatcaATAACGCAACCCAATTTCCGGTGTTTAGTTGA
CGTACGCTGCTGTTTATAAAGCGCGTTCCAGCCCCTCAGCGCCgcctcgttcttctccagcatcgtctGGATCTCTCGCTGCGATACCGAACGCCCCGGA
GTCAGCAGCGCCTAATAGTCACAATAAAAATATACAAGTTAAGTAAAATTTTGTTTAGCAAGATAAAATCAATATTCCGCGGCGGATATTTTGCTCCGTT
CTGGCAGTTCACGCACCTGCGCCACGGCAGCCGCGCGCTGTTGCAGCGGATTAACGTGCTCCCTGTTGGATGCAAAAGACGCATAGAGCGTGTGAGAGGC
TGGCGGGGCGCTagaagctgcagacggagCCACGTACGgcatcgaggacgacgccatgctTAGCTAAAACAACGCTAGATAAAGGTAAGAAATAGGATTT
GAATGTTCAACCAATCACCGAATTATACTATAGAAACAGCCAATTAGAAGCAAGACCTAATCCTTTATGAtaagctgaagctggtgttTCCGGTACGGCT
CACTTTACGTATCAACGataagtgagtgagtgacACATGACGAGTCTCCGCCCCACGTGTGTGTCTGCGCCTGGCAAAGTGCTGCTTGTGGGTGGGTatc
tggtgctggacgaaCAATACGCGGGGCTCGTTTTGTCCAGTACTGCGAGATTTTACTCCCAAGTGGATGTGAAGGTAAAGTGAAGTGAAGGTACATTAAC
AGTGGATAAAATATCTCAACGGAATTGATTTTTGTGTTTATTGCAGCCtcgagatgacgacgacgcggtGTTAGCGGCTTCGAGTGAGTGGCGTCGACTG
TTCCCGATGACGGTGGAGAGTAAACAGTTCAACCAGTTGATTGACGGCTGGATCGAGGAAAATGGCGACGGACGATTCCGGTTCCATCTCAGGTGGCGAT
GGGATGCCGAGTTTTAGTTAATTGTGGAGAGGTTGCTGATGCTGAGTGGGTGTGGTGGTTGGTAGGGAGGGTTCGCATCGGAACGCGTACATTGAGGAGA
CGGTGTTGTGTGCGATGAACGGCATTGCTGGATTGGAGACGTTTAAAAGCAACGATACGTTCCGGGTGCTagcggagacgaagacgggCGTGCACGTCAC
ACTTCGGGGTGATAACGATTTTTACTCCCAAGTGAAGAGGGTAAGAGTGACTTTAGAGCATGGAGGTTTGCTTGGATTGACGAGGCATGGGGTGGTGCTT
GACTAGCTGCAAGACGCCAAGCTGCCACTTCGTCGCGACAACTTGAAGGCACTTGATGTTTTCCTTCCTCCGACAATGGAAGGTAGGACTGGCATTTTAT
AATAAGATGCTGGGTGTGTGTTGTTGGAAAGCTTTCTGACAATTGAAGTGTAGAGCGTGGCGACAAGCTGATTGCATTGAAGACAGGCATGGGGAGCTCT
GCCGCTCTCGTGACGTCGCTTGTTGCGGCTCTTATGGCATTTTTTGTGCCGGCTATGAACTTTGAtgagcagcagaaggaccTAGAGCTGGTGCACAGTT
TGGCCCAGTTGAGTCACTGCTACGTACAGCGCAAGGTACACTCTGAAGTTTTCTCTCTAGCCACAGCGCTAGTATGGTCGAGTAACGACTGAGCTGTACT
ACAGATTGGAAGCGGCTTCGATGTGTCAGCGGCATGCTTTGGTTCTCAGCGGTATACCCGATTCCCGGCATCAATTTTGAACGTGTTCACGTCCGAAGAC
GCGATGAAACCGGAGGAGATTGCGCTTTGCATTACGGACCGCGCGCTGTGGAACACTTCTAACCGCGTGGTAACGGCAACTACTCAATCTTTCAGCATGA
TGAGGTTGTTTTTGCTCGTTCTAACGGAAATTTGTTGCAGAAATCAGTTCGATTGCCTTCTACCTTCCACTTGATGATGGGAGACGTGTCATCAGGTTCG
GCGACCGTGTCGATGGTTCGACAAGTGCTGAAGTGGCAAAAGGATCAACCTGAGTACGCGCTGCGAGTGATGAATGCAGTCCATTGCCATAATACGGAGG
TTGAGCGAGGTTTCGCTAAAATCTGCGAGCTGGAGTCGAGTCCCAGTACCCCAATTGATTGGGAAGCGATGGCTGCTCAAAAACGCCATCAGGTAGACAG
ACTCATGGTGCCATACCTTTCTGCTAGTTATGCTCTGATATATTTACCACCATGTTGATGGATATTACTTGTGCGTGCAGTGGAGTACTACGGATGCCAG
AATTGGGGCTGTACTTTTGAGAACCAGTGAAGCCTACGCTCGTTTCCGAGAGCTTATGCGGTACGCTCACTACAGTaattctacatgtagttttcAATGC
GATGCGTTCTCCGGGCATCACGTTGACGTTTTCTGCTTGTATCGACATGATAGTGAAATGGGAACTTCTGCCGGAGTTCCGATTGAGCCACCTGAGCAGA
CGGCTATCCTGGATGCAACGCTTGCGATCCCTGGTGTCTTGCTCGCTGGAGTGCCTGGAGGTAGAGTCACACCTTCCATTGTGCTGGTTTGTGGGGATTA
AGCTCACTGTTGATGTCTTCAGCGGGTGGATACGACGCGATttgtgtggtggtgcttcaCGAGCGAGTTCTccaagcagttgaagacCTGTGGGTCCAGT
GGCCTTCGACGCACCCTGACTCCACGTACGTCTCTCACGCAAATGTCATTTTGTACACATTGCGTCCAATGTTAATGAGTGTTTCTTTGGTTTAAACTAG
CATATGTCCGCTACTGTGCGATGTCGACCGTGGACTAGCGGGGTCGTCGGCTGCGAGATCtgggcttcaacttcacTCCGTTGAGTAATTTTGTGACCAA
CTAACGCCGTTGACACGAGTGATATGACATGAGGCTAGACTAACTTTCACCTTTAGTGTGTAGAGTGCAGATCAAAGGTAAATACCCTAAAGGGGACGAC
GCATAAACAAATCTTAGTCGTCTTCAATCGCCCGTCAGGGGTCACCAGCCGGGTATGCAGAATATGTCGAAGCGGAAGATCcgtgatggagatgacgtTG
AGGGAGACAGGATGACGAAAGCAAGCTACCCACTGCGCAACCAAGAAAAGGTTAGTCGAGCGGAGACTtcggagcaggagcagcatgGACGCTTCTCAAT
TCCAGGACTACGGTTTGCGACAGAGTCTTGGGCTGGAATGAAGACCAGCAACGAAGATCGTCATGTATCCTCCGTTGATTTCTTTCCTGGTCCAGTGTTT
GGTATTTTTGATGGCCATGGCGGAACGTTTTCAGCAGACCTCTTATCCCGGCAGCTAGTGAAGACTGTCGCCTCTGTGATGCGACAGGATCTTGGAGGAA
AAACATTCGCTGACCTGCGCTGTTCCCAAGAACAGTCGAGCCAAGAAAAGGCCGCAAGGAAGCGATCGTTGAACAAACAGCGGCGTTGCACCAACAGCTC
GCAGAGGTGGAGGCTATGGGGTCAGACTCCTCCGTTCCCGAATCAGAGAGCTCTGCTGACGAGTTACAGGTTTTAATCGACCAACTTACGGATGCTATCT
CGCAGATGGATCTCGAAGTGAAGCAAATTAACGCCGaggaagcagcacgtcgagaGGAGAGGTGGCAGTGGTGCCATAGACAGCATGATCACTTCTTGAA
ATCGTTCAAGGCATCCTTCCAGCGAGTCGATTCACTGATCTTGCAGAAGAATCCATCGCAAGATGGTTCCACGGCTCTCCTGGTTTGGTTCTTAGCCGAC
TCGGCCAGCTttggtgacgatgaaaaTGCTGTGGGAAGCGTGGTGGTCAACGAACAACCAACGGGTGAACTGAGCTTCTACACAGTGAACCTAGGTAATT
GCCGTGCAGTCATGTGTCGTGGTGGCCGAGGTGTATTGCTCACAAGTGACCACAAGCCCGATCGCCCGGATGAAAGACAGCGGATTGAAAATGCCGGTGG
CTTTGTGGGCAAGATTGCAGGCATATCTCGCGTGTACTCTGCGGCGGGTGCTGGGTTAGCCGTGCAACGTGAAGCGTCTACGTATCTGGCGGTGTCGCGT
GCATTTGGTGACCGATGTCTGAAGACCCCGACGACGCTGGTTTCGTGTGAGCCAGAGGTGACGCGATTCCAAGTGCTCGCTGACGATTTGTTCCTCGTAC
TAGCCTGCGATGGCGTCTGGGACGTTTTGAGTGAGCAAGATGTGGTTGATATTGCCTTGCCACACTTTCACGACGCCAAAGCTGCCGCGGACACGATCGT
AAAGGCAGCCTACAAGGAAGGGAGCGTCGACAATCTAACAGCTACAGTCGCCCAGTTTGGCTGGAAGGCTAAGCTTAATGCTCAGCTACAGCAGGTGCTC
GAGAGCGGCAAAGTGGCCAAAGCAAATACCCCTAAAGGCAAAAATTGCATTCCAGCCAAAGCACAGGGAGACGATGGATCAGAGGAGGAGATTGACATGT
TCAATCTATGAGCTAGACCAGCTTTTGATAGCAAAGTGATTGAGTCCGCCCTAGTTTGGTTGATATCCTTGTTCGTACGACACAATGAGATTCCGTTGTT
GAAGAATCTGCACACAGTACAGAAGGAGGAGAGTGTTCAGGATAGACACGCCTTCCATTCACTACcataacaacaacaagaggCACCTCTACAATTGGTG
TCATCGCATTTGCATCATAGACTCGGAAGCGTACAGGTGGCACCGGTTGACGATCTCTTCGCTTGTGTTTGCGCTGATCGAGCACGAACTGCTGGTCCAC
GAACACCTCAgcctctacatgtactcgtacgCAGCAAGACGAAACCAAGCATGCCCGTGAACATTCAAGCACCAACAGAAGATGATTTTATCAGACCGTA
CCCACGTGTGGGATGGCAAATCCCCCATTGACCACCATCGCATGCAGCTTGATCGCTGAATGCGCTGGCGGGGCGACGCGGAGCACGCGGTACTTGGCGt
ccaggtgctggtgcaggaagTCTACAACTTTATCAAACTGCGAAAAGCATGGCGTCAGGTGACATGGGATCCAATGAATGATAGAGCTGGCTGGATACAA
CCAACACGCACGTCCTGCTCGACATTTGCTCCACGCCGCCCGCGCTCGCCTTCCAGCCGCGAAAGGCGGTACGTGGCGAACAGAATGGCCACGACGATCA
CTAATACGAAAGGTCCAGTCGATCCATACATCCGTCACCAAGATGTCAAGGGGAATAGCAAGTCAAGTCGAGCCGAGTCAAGTCAAACCTAGcgcgtgct
tcttgagcgagtccAGCATGGCACGAAGAGCTCACCAGTCAAATGTGGCGGGACGCAGCTCACACTCAAAGTCATACCGTTTCAGCTGGTGAGCTTGGGA
TCCTAGCGAAGCTGACGCCAAAGAAACAGATCAGATAAACATCCGAGCAGAACCAGTGCGTGACCTCCACGcgtggacgcagcagcagggcgTGTCAAGC
ACTTCGAAGCGTTTGCGAACAAGGCCCGAGCCTTGTCATTGGTGGCGACACCGGCGCGTGTGGTTGCCACGTGCTCAATATACTTTTCAATCTTTCGGCT
CGCGCGTCTATGACCGGCTTCACTGCATTGACGATGCGACCAAAGTCAACTGAGCTTGCCCCCGATGTCTGTAGGCGCATCGAATCTGAATTGTGAATAC
GTTGAGGGACACATGCCGCCGGCGACATGGAGACGATCCAAGTGGCAACAGACGTACGAGGTAGATAAGTGCTGTACATTTTACCAATAAGGGGCGGGTA
GTAGCTACAAGAAGGCTGTTGTCACGCTGGGGTCCTCTTCTAGTCAAGATTCTTTTCCTTTTCGGCGCCGTGTGCGTCGTTCTTGACGGGTTTCGGTCCG
ACGAAGGCGCAGGGCTTGAGTGCATGTCGGTCCATGAGCATCTGGGCGACGTTGGTCGGTTCAGTTGATGGGGAATCCGTTTGCGGAGACTGCTCCGCCC
GCTGCGCCTGCAGAGCCCAATCGGCCGagtcgaagcgctgcagacggaggCACCGAAGCTGTTCGTGATGCGCGGCGGATCCCGGCTCCggctcctgctc
cagctcggtgCCGTCCGACGGCGTGCACTTGCCGCACGTGCAACCGGCACACGGCCCCGAGGCTCGTTGTGCCATCTCGTAGTCGGCCGAGTCGAAGCGC
TGGCGGTTGTCGCGATGACGCTGGATGATAGTGGAGGCCACGGAGTGCGGGCAATCACCCGTgggctggtgctggtgctcggcCGCGACTTTGTCGGTGG
AGTTGGCCATGCTGGTTCAAAGGCGCGGAGTGAACGAGGGAGTGAGTGTGGAGGACCAAACCAAAGAATGAATGACCCGTGGCACCGCTGGCGGTGACGC
GCTGCAAACTGCTGCCTGCAGTACACTGTAAAAGGTCGCAGAGGATGAGTTCCCTCGGAGGCTGTGCACCAGCCAGTCGTGATGTCGTTGGAAGAAGGGA
TCGATTTTTTTTCTCACCAACGGCCTCGGGCTCAATGCTCGAGGCTCCTCCTTGCTTGCTGCGTGCAAGGTGAGACTTCGCACACCTGAGCTCGCCGACC
TGACCTGAGCATGCGACGTGTGCACACTTGGTCGGAGTAAGAAGGCCTGGGCATGAATTTTGGGTGAAACCGCTAAGCGAAGGCGGTTCCATGATCTTCA
ACGATTGGCGGTGAAGCGGGCGAGTACGTGATGAGACCGTGCACGGTTACAGCACGCGCCTTCGCCGAAAGCGGCGAGAATGTCGCTGCGTATTGCTGAT
GTCGGTCGCTTGATGTCGCTTGATGTCgcttgatgatgatgtacctgcacctgcactgCATATGCGCGCGCTCGTTTTTCTGGAGCGATAGCGTGGCGCT
GTGCTCAGGCAGCGCGTATGAGGCAAACACGGCCATGATGGCGCTGATGGCGCTGCTAATAAGTCGGCGGGGCAACTGTCAAAGGGAAGTGGCAACGGGG
TGTCGACAATGCCAAACGTTGTCCATGAGGACACATCGTTTTTCGTGGTAGGTAGCAGTGTCTCTTCTGCTCCAACCGCGAGAATGTTGCGGCGACTTAC
AGTCAGCGGTATTTACAAACCGCCTTACAGCTTGTCGACGTACGAGCCGTCCTCTGTGGAcaccttgaccttgttgccGATCTCGATGAACAGTGGCACC
TTCACCACGGCGCCGTTCTCCAGCGTTGCGTCTTTCACGCTCAGCGCCGTATCCGCCACGCCTTTCGGTGTGGTTTTCTGCGAGAAAACGACATTGAAAC
GGCATGATTCAGCCACCGAGAAGGAGTTCAGGCCGCGACCAGAGAAATGAGTATCTTGCCACCAAAACGGCACTTACCGTCACTTCGAGCGTCACGTGCC
CGGGCATGTTGGCCCACAGCACGTCGCTCTCGATAATCTGCAGGGACAGCGTCATGCCCTCCTGCAAAAAGTCCAGCTGACGACCCGAGAACAGGTCACG
CTCAATCTCCATctaccaacaacagcagcagcaacaacagaatATCAATGCAGTGGATCAGCCTCTAGACCTAGCAGCTCAaatatcagcagcaaacagc
aagGCCGCACCTGCTCGAACGTCGTGTTGTGCATGATGACGAGATGGTCCCCGTTGTAGTACAGGAACTGGAACGGCTCGTCCGGGCCCAGCGGCGCCTT
GTTCACAGTCTCTGCAGCACGGAAGCGGCGGTTCATCTTGGATCCtgtcttgatctccttcagttccgcctgcagcagcaattgacACGTTTTTAATGAG
TCTTTCCTCACGCTAATATGCACGGATTTCCGCGCAAAAAGCTGTGACTGAACGCACCTGGACGTATGCTCCACCCTTGCCAGGTTTCACATGCTGGTTC
TTGCCCACGCGGTAGATTTTGCCGTCGATCTCGAGCGCCATGCCTGCACGGACCTGGTTGCCTGTTCAATGAAGTGCACCATAGCCAGTTTGAAGTCTTA
GACGACAATTCAAGCGTGATAGGGTAGCTCATCGATTGCTAAAAAGAGTAGTACTACCATTGATCGTGGTAAAGCGCACTCCGTAGCCACGGGCAGGCGC
CGTCGCCCGCGCGATCTGCGTGATAACTCGCCGCAACATCATCGTAACGTTAAGTGGATTTTGAGCCTCTCGATTCCTAGGCCCttctgtgattggctaa
aagTTTATTCCGCCACAAGCTGAACAGTTATTATCCCATTTCGGTGGCGCAAGTTAATCATCCATGATTGGATAAAAACATTCTGGATAATCCAGGTCGA
AAGTGGATTCATTCTTCAACAATATCGGGCAGCGTTAAGTATGTTTCTGTGGCGCTCTAATCGTCCCGAGGACGCGATCCGGAAGGCTATcgaggcggcg
gtggcagccGACAAGGCGGAGAAGTACCAGGAGGCAGTGGAGTTGTATGCGTCCGGCATCGAGAAGATGatggcgcagctggcgcgtacgttgaagcaga
aaaTCTGTGCCACAAACAACTACTCTTACTGAGGCGTTTTCTGCTGATTATGTAAGTGCAGAGCTgccggacgacgaggccaaaACGCAATTGCGGCAGA
AGATCAACGACTACATGCTGCGGGCCGAGTATCTCAAGGAATGGACGGCGGAGCAACAAACccccaagcagcagacgcagacgcaggtCGGCCATGAGAC
CCACAGAAGAATGAGGCGAAACGCTCGTGATTTTAGAACGCTGTAGCTGATATTTTGTGTGTTTTTGTGTTGTGTAGGATGCATCTGTGCCAAGCAGTCA
GGAGGGCAATACACGCACTGCAAGTGGCCGACAGGTTGAGAAGCTAGTGCATGACaaggtgaagatgctggtaGGCTGCCTGGCTAACAACGGATTTTAC
TcgtgctggcagcaacagagaGCGGCCTATTCGAAGCAGCACGCAGAGCAAGCTCATACTATTCTGGACGAGGTGTTGGACCACTCTCCAGGAGTGCATT
GGACGGATATTGCCGGTTTGGGCGTTGCAAAGCAGATTCTGCAGGTCTGGCTGGGATCGAAGGTCCTGCATTAAAATGGCGATGAATAGCTGTAAGACTG
ACTGTTTGAGTTGTTTGCAAGTAGGAAGCTGTCATTCTGCCCACACTGCGCCCAGACTTATTCACTGGCTTGCGGGCGCCACCTCGCGGGGTGCTGCTTT
TCGGGCCACCCGGCACAGGTGGGAAAGTTACCACCGGTAGCATGTTGTGTGAGCGTACACAGGGGCTGCGAACTGATGTTGCTTCATATTTTGGCGCTGA
CCTAGGTAAAACGTTGCTGGCGAAAGCTGTTGCTACAGAAGCGAATGCAACTTTCTTCAAGTACGTCCGTGTTTGGAGACGATGTTTGGATTGCTTGACT
GCTTTGTGTGTGTCTTACTGATgcgtgtttgctgcagcatttctgcgtcgtccttgacATCCAAGTGGGTGGGCGAAGGCGAGAAATTAGTTCGAGCGCT
CTTCGAGATGGCCCGGGAGCTTCAGCCGTCTGTGGTTTTTATGGATGAGATCGACGCTTTGTTATCGACAAGGTCAGCGTCCGAGAACGATGCAAGCCGA
AGAATCAAAAACCAGGTACGATTTGAAGTCTTGGCACATCAGTTTTAACACAGCGCGCTGACAGTTTTGAATGCAATTCACTGCAGTTTTTTATTGAGCT
TGATGGAGCTGCGTCATCACAAGAGGATCGAATTCTCGTCATGGGAGCTACGAACCTCCCCCAAGAGCTCGACGAGGCCATCGTACGCCGCCTGGAGAAG
CGCATTTATGGTAAGTGATGCCTAACCACCTCACCTTTGAATGGAAAATATGAAGCGTCTAACTGACTCCGTGGTATGGCTGTTGTCAGTGCCTCTCCCG
GATGCTTCTTCTCGTGAAGGACTTATCCGACATCTACTTGATAGCCAGAAATTCTCCTTGTCGTCTAAAGATATCAAGCACATCGTGAAGGCGACCGAAG
GTTACTCCGGCAGCGATCTCAAGGCTGTATGCAAGGACGCTGCTCTGGGCCCAATTCGCGAGCTTGGCGCAAAAGTAGCGAACGTGAAGGCCGAAGAGGT
GCGAGGAATCAATGCATCCGACTTTCAGGTGGCGCTCCGGCGAGTCCGACCAAGCGTGTCCTCGACGACGATAGAGTCCCTCGTCGCATGGAATGAACAA
TATGGAGTGTCCGCAGTGTGATGAGCTCGTTCGCGGCTATATTTTCAAGGGTGCTTACGCCTTCCGCTCGTAAATCATCAAGTACGACTCGGACACCCCG
ATTAGCTGCGGCATCGTCTCCTGGACATGCAGATCTTGGATTTCGTACCACTGCTCGGTTGCCTGTGACAGATAAATGCATGAACACGCCGTAAATCAGT
TTTACGTTGTCGATCCTGCGTACACAGGTTCTCAAGCCACATACTCTATTCTGGACGTGAACACGATAGCTGCCTTCCGTCAATGGATTCGTCTGGAGCG
CTGCCTCTTGACCAGTAGTCACTGGGCTGTCATGGCAGATATTGGCGATCAAGTTGTACCTGACGACAAAGTCACATAACACAGCAAAGGTAAGTTAACC
TCAGTTAAAATAATACCGCGAGCTATAGCGCAACAACAACCGGCACGTACTTGGTGGATGGCAACGTAACGCGCAAGATCTTCTCGACTAAGTCGGCCTT
TTCAACACAATCCTGCCACCACAAACCATACACATGAAACCACTTAAACCTCGTTCTCTTTAGTCAGAGACCACAGAGTAGCTCGCACCTCAGTCGACTG
GTTCTGATTGCGCAGAAGAGCTCGCAGCTCGGAAATCGACTTATTTCGAAGCTCCTCCTTCGACGGGAGGTTTTGGTCCAGCTTCAAGTAATTGCGCAAC
TCGAGATTCTTGACGGGGAAGTTTACAATTGTCGGGTTCTtctcgatgaagaagttgttTCGCGTGAAACGCTTTACTTGGAAGATCAGGTAATCTGGCA
GTGAGTCGATCCGGTAGGTCTTCTTGAGTCGATGAGAGCCTTGAAGTACGTGCGTGACATGGGAACCATTGTACTTCTCAAGCACTGTAAACAGCGGAAT
CTTCACCAACAATGCAATCAAAAGCGTCAGCTTTCCACTCCAGTTCGTCTACCCGCTCGAATTCAATTGCGCTCACCTGAGGAATGATGTTTCCACCTTG
AGAATCCTTAAACAGTGGTGTGGACGGCAAGTTCAGCGCCATCATCCTACACGTACAATTGCAACATCACACTCAGAGCTACGCATAGACGAACAATCGA
TGAGCGCAGTGACTTACAAGAACGGTGACACCGTCGTTGAGACAGCTGCTTCGCGTTCTGCAGGATCTCCTGACGCAGCTTTCGTTTCGTCGTCCGTTGT
CACCTCCACGAAACCCTGAAAACACTTGTGGATGATGCTACTCCCCGGCTTGTGCGACCCGCCAAGTCCctacaacagcagcatgccACATTAGTTCCAG
CACTTTCAACGCAACAAAGCAGCAGatttctcctcctccttcgtaCCCTGTGCAGCTCATTCAGCAGCCACGCCAAGAGCTCGACGCTTTCATTTTGCGT
TCCGACGTGGAacctcttcttgctgctcaccGAGATCTCCTGCACCAGTTCATGGGGActgatctgcagcagtcacATCACAAGAACCAAACACCCAATG
AGCACCCCCGTACCAACCAAAATCAAAACCAAAACATACCGCCAACTACATGCACCCACCGtgttcttgaagttgtgcgGGCTCCacatcttgcgcagca
gctccccGAAGCGCAGCACGAGCTTGGACTTGACATTGCCCGTCTTGTTGGCAAGAAAGAAGTCTCGGAGCGGCGGCACGTGGGCCAGCGCCTGCACCAC
CACATTGATGTAGTCCGTGTGCTTGAGGTTGTTCAGGCCAATGAAGCCTGGCAGATACGAGACCCCGAAGGCGTCCTGCGCCAGGATGCGGTTCTGGTCC
AGCCGGGCGATCTGCGCGGCCTCGAACGTCGGACGCAGCGCGTCCTGCACGGGCTTGAGCGTGTGGTCCACGACCTCATAGTTGTCCGGCAGGCAGTAGA
TGCGGTCTGTCTGCAGGTTGATGAACACGTGGTGGCTGCTCTGCACCGAGTGCGTGAAGGCGTGCGTATTGCGGCCGCGGCCCTTGAAGTACTTGCCGCA
GACCAGGCAGGCATAGACGTTCTGGTCGGACAGACTGATGGAGCACACCttctcgaagtcgaagtccagcagctggtggttgATGGTGTCCAGGTACGGG
CACTTGCGGcgcttggcggcggcggcttcgtccGCGACGGCTTcggccttgcgcttggtgGCGGGCATCGCTGCTATGCTATTGCGATTGATGTCCCAGA
TATCAAGTCCCGTTTGGATTGTtttctgattggctaatgGTAGTGGAAATATGCGGATTGGATGAAAAGCAATGATGGATAACTTTACGAGTTTCATCCA
ATCGttgagcaccagcgtcttTGCAGATGGAATACAAAAAGCAAGTCTAATTGATCTTCCCATCGTCTCGACAAGCTTTGCGGCTACAAGACCATCGACA
CCAACCGCGCGTGaaccactacatgtataatcAGTAGGAGCAGTCGGTACCCAGGATTAATATCATCGCAATCTGCATGGCATAGTGTCGACATGTACAA
CTGCTCTGACCTTCCCGTAGTTGCTACCGCGCTAGATCATCTTCCTTGCCTGTTGTGTCGAATACTGGGTGGGGGACACATTGCACGCTGTGCATGATTT
GATCCGGCGACGTCATTGGTCGAGGGGAGGGGAAATTCGCACTTAAATGGATATTCGGTCCTGCGTTGTTTTGCGGTGGCCGCTGCTTGGACGTCTCACT
CCACAATCCGCCACCAAGCAGAAAGGAACAGTCTCCGAGATGATGATGCTCCGTCGCTCCACCGCCGCGCTGGCCCGCAACGCCGCGCCTGTCATGCGCG
CCTTCAGTGCCGCTGCCAACGCCTCGGGCGAGGTCAAGTTCGACTTCGCCTCGCCCTACGAGCTGCACCGTacgtcatcatcatcagcagcagcacagca
tcCTTGATCTCCACCGGACCATCTCTCATAATTGATATCTAAcgcagagtgatggtctttTATATTGCCCTAAATGCAGGTCTGGAGGAGGGCCCGGCCG
AGTTCGCCGTGACCAACCGTGAGGAGATGCTGAGCTACTACAAGCTTATGTACACGATGCGCCGCATGGAGATCACCAATGACAACGAGTACAAAGCTCG
CACCATCCGCGGCTTCTGCCACCTGTACGATGGCCAGGAGGCCGTGGCCACCGGCGTGGAGGCTGCTCTGGACCGCACCGACTCGTGGATCACTTCGTAC
CGTAACCACTGCATCATGCTCGCCCGTGGTGCTGAGGTCAAGGACGTCCTGGCCGAGCTGTTCGGCATGAAGGACGGTGCCACCGGCGGCAAGGGTGGCT
CCATGCACTTCTacaacaagaaggccaaCTTCTACGGTGGCCAGGGTATCGTAGGTGCCCAAGTGCCCGTGGGCGCGGGTCTGGCATTTGCCAGCAAGTA
CAACCACAACGGCGAGGGCCTGATGCCCTGCGCCATCACCATGTTCGGCGACGGTGCGTCCAACCAGGGTCAGGTGCTCGAGGCTGCCAACATGGCCGCC
CTGTGGAAGCTGCCGGTCATCTTCTGCATTGAGAACAACCACTACGGTATGGGCACGTCCGCCCAGCGTTCGTCCAACAACACGGACTACTACACCATGG
GCAACAAGATCCCCGGTATTAAGTGCGACGGTAACGACGTGCTCGCTGTGCGTGAGTGCACCAAGTTCCTGAAGACGTGGTGCGGCGAGGGCAACGGACC
GAtcttcgtggagatgaaCACGTACCGTTACCACGGCCACTCCATGTCGGACCCTGGTGTGACGTACCGTAACCGTGACGAGATCTCGCAGATGCGTGCG
TCGCGTGACCCCATtgagctggtgaagaagcgcatgATCGAGGCGGAGCTTGCTACGGCTGACGAGATCAAGgacctggagaagaaggtgcgtGCCGAGG
TCGTGAAGGCCAccaaggaggccaaggcctCGGGTAAGCCCGAAGAGGCTTCGGCCTTTGTGGGCGTGTACACGGACGGCAAGGGCGACAACGAGTACCC
GCCGTTCATCCGTTTCCCCGACTATGCCAAGAGCCTGTACAACGGGAAGCGCCAGTAAGCGCTGAACGCAGGAAGGAGGACACAGAGCAGCGAGAGGATT
ATCACCCCTCTTCAGGACAAAGCGCCTCGACAAGCGGTagaagctgcgctgcgtcgcctTGTATGTCCTCCATATTTCGGCTGGCTGCGAGCATGGCGTC
GAGTGCGCTGTGTAGCGCATTAGAACCCGCTCTAGGAACAGTCTCGTAAGCTTTGCGACCCCATTAATACCGACTGGATATGAAAAACGCGCCATACACG
TTCACGTTtgatactacatgtattaatagtagtACATACCTAGCGTGCGCTTTCGTCGACTGTGTCGAGTCCTGCTGATCCCACACCTTCGTCCTACGTT
AGGTGAGAGCTGCCTTGTGCGACACTAAGCAGAAAATCACGACCGCCATCCATCAATTGACACGGCACTCGTTGGGCTGAGCATGTTTCTTTGGCGTATG
TCTGTACCGGCGGCCACTATTCAAGCATTTACTATATTATACTACAAAGCTTAGTACTAATAATacatactacatgtacaaggtGAGGATGCTATATTAC
TACAGTAGTATTTactagtattaataatacatacTATTACAAAGTGAGGACTGTAATAGGCTGCTCAATTCCtacgttgaagctgttttTACGATACCAT
CATGCAAGTTCACTTGGCCGTGGTTCCTACGTCTTGGCTCCACGTGCGTGTACATGCTTCTCCTACACATACGGACTCACATCTGCACTACTTGCGGCCG
CGCATATTTTTCTACACTACTCCACCACTAACTAGTTCACGGTCGGCCGCTAGGTGCGTCTTCTTacttgttcatcttcatcttcatcgtcgtcctaCCG
TCGTCATATTTTCCCGAACGGCTGAAGCAGACAGCGTCTTAGCTCGAGTATAGcactgctccagcgcctggGGCCGCTTCAAAGTCGCGGTGGTGTCGGG
GTCGACGACGCACAACTGgactgttgttgctgctgctgttgccaccATTTCGAAGCATGGGTGCCATGAACTcgtgctcctgctgcaacGCCACAATGCG
AAAGTGCGAGAGCTTTCGGGCTTGCTGCGCCAAGTTGTTGGCGTGATTGGCGGCGACGATGATGTTCTTGGCGCGTGTCATAGCCTCGTTTAactcgaac
ttctcctcgtcatcttctcctggGAATTCTTGGTTGCTCTCGTGGTTGATCGGGACGCGTGAGCGGCCAGTGCGAAGACTCGCGATAGTTTTCGACGAGG
TGCGGCCATGCGCCGGTAATGGTCTCATGATCGAGTACGTGGGCGAAGcggatgacgacgacgtagtagactcgtcgtccgtgttGTCGTTTTCGTCCGA
GTAGTCCTCTGGATGGCGCTCAGCGTTGCCCATGCGCATTTGGTACAAGCGAAAGGCCTCGATCGAGATGGCCAGGTCTGCTGGGCTGCCACGGCGCTTG
GCCGCAAACAGCGCCTTGTTACGCATGACGAGGCCGTCGCTAAAGGAACGATTCGGGAAGCTGGCCTTGGGCACACCGATGGCCGAGCCCGTAGTAGTGG
CGCTGTGACCATCCTCACTACCCGACGAGAACGTCTTGTACTCGATGAGTCGGGAGCGCACGGGATCAAGAAGGTTGTCGTACGACCGGCGCTTCGGCCC
TTCCTCCTTTGGTTCACGGCTGGCAACTGAAAAGCTCTGCGCACGACCCAGCACGCGTGTGCTCTCGTTCGTGTCAGCAAAGAATTGGTTCGAGGCTGTG
GAGCTGAACGACGGAGTAGCTGGCGGCTCCATACCACTGGCCGTGTTGCGTGACGACTGACGAGCTTCGATGACGCACGCAGTGCATACCCGTAGCTGAC
GTTCGCCAATCTCAGGCACATGTGCACTACGCACCGaactgcacgagctgcagcacactTCCCCACACTTGAGGCAGTTGtagcgacggcgacgcacACA
AAACTTCTTGGAGCACATGCGGCAGTGATCTCGCTCGCTCATGAGGATGACTTGCTGGGGAAgcacgatctcctcgcgACCCACACGGAAGTTCTCGGTG
TACTTGAGAATGCCGTTGATGCACTTCTCGACGTGCGATTGAATAGCCGAGCTGGCAATCCAAGCAGGGAGGTCGCcgttcttgttgaagttgcaagtGT
AGGTCATGCGCAGCTCGCCTGACCTCTTGGTCGAGTGATACATGAAACCCATGAGCGGCACGAGGTCGCGCGTGTACTTGGGCGACTCGGCGTACTTGGA
AAATCCTGCGGGTGTGTCCACGGACTCCATAATGCGGAAGGCGGTCATCTGTCCCTGAGCGTCCTCGATCATGTCGACGTACTCAAGCATGAGCAGGTCG
CGATCCTTGGCAAATGGGCCTGAGCTCTTGAAGGCGGCCCACTTGAGTGCGACGTAGCGGTGTGGGTTCGTGGGCGTGGGCTCCACAATGTTCTGCACCA
CTGCGCCATCCAGGAAATCGGACGACAACATGGCCATCATCCGCTTgaacgacgtcgtcgtgggcGTGATGAGCGACGCCGCGACGTCTTTGATATCGCA
GGCGAACTTGCACACCGCGTGGACGTTGCACGGCACGTTGGTGCCCGCAttggcgtcgtcggcttGGAAGAGCGAGATCCCGTGTTTTTCGTGCACCAAC
GTCCACGGAATTCCTCCGAGCAGGTCGGTGGCTTCCAGGAGACTCTCCGTCATGCGCTTGGCCACCGTCGTGAGGCGTTCGCGCTCCTTGACGCACATTT
CCgacacctcgtcgtcgctgtcgtcggtgCCGTCTGAGCCGTTCGAGGAGCCGAAGCTGGCGAGCGACCAAGGGGTCAAAGGGGTCCCAGCCAGGACCGA
CCCCGTTGTGGAGCTGTAGTCTGTCATGGATGGTATTGTATGTGTGTAGTGTGTATTGGATCGAGCACTGCTTAATCGTCTAGGGGGTAGTTATCGCAAC
GAGACGCTTGCAGAATTCCTTCGCGACGTTCGCGTGGAAGCTCCAATGCGAAACTGAGCGAGTTTCGGCCGAGGAAGTGCCGGCCCTAGGCGTTTCTCGT
CCGTAACAGTTTCCACCGCACGTGCGCTCGAGTCACTGGACTCTATTTAGTGCGAACGGCTAGTGGGCGGCTGAGCTTGCCCAGGCAAGTTCTCTTCTAT
TTTATCTCTGACGTGCCCGGCCGAGGCCGGAAGATCAATAATATCCGCTGCCGACGAAATCCACCATGATCCGAGTAATACTAAGTACCTTGCTACAGCC
ACCTCCCCCGAGACAGCCCATGGCGATGGCCGGGAGGTAGTTTCGAGCCTGGCTGCACACGCGTCAAGCTGTGACTTTGCTCGTGTgtcaacagcaccaa
cgccgGTGTTTCACACACCGCGCAGTCCAACGCTCTGGCGCCAAATATGggcggcgacttcaacgtACCAGTAGCAAGTGCCCACACATACGAGATGACC
ACCAAACGTACACTTTGGAAGGATAGAAGGCAGTCGTCACTGGCTCGTCAGAGGTCAGACCAATAGCGTGGCGAGTCACGCTTGGCACTTGTAACGGCTT
GGCGGCGGAATGGAGTTTTGGTCGGGATGGCTCTGAAACGTGGTGAGACCGCGACGCACACCGCGCGGGTCTATGCGGCCTTGTAGTCGAGCCCGCGCAG
ACCAGTGCGAGAGCTGCCCGCGAACACAGCGACCGCCTTTGAGGGAGTGAGACTGCCACACAAGTCCAGGTACGCTTCGTCACGCATGGCCACGAACTCG
GTTCGGTTTCAATTGAGCGTGGTCGTGTCCTCAGGTTGCACACACCACAGGATGGCAGTCACTGGCGACCATATCCGACGGAGGACGTAAAGGGTGAAAG
TGTCCAGGCCGCGCGTGAAGTGAATGCGAGCGAACGGAGGTTGCCTCCGATGGCTAAAACGATGCTGGGACCACGAAACTATCGCGACGACTGACTACAG
TACCAGGCTTCGAAGCGGAGCGAGCTCGTTTCGATCAAGGCACTGGCACTGGGATCCCAGACTCCTCCTGACGCTTTGCGTCCAGCGCTGTTTGTCGCGG
AATCCTGCGCGTAACAGCGAGCTAACTCCCGATGCTCAAGGTGCCGCAAACAGTGTTCGCAGATGACCGGTAGAACACCCAACACTGGAACAAGGGGGCC
AAACACGCTGCAAGGATAACTTCAGTCGTGTCAGAGTAGCTTCTGTCTGCATGCAGGTGGGAGGGTCTATACTTCCTGAGCGGAGGCCTGTGCGCTTTTG
TGAGACGTCTAGGACATTGAATGATGCCGAAGACGACTGTTATACCATGGTGACCCTTTTTGCAAGGTTGCTTGCTTGTTACAGTAAGAAAATAAAACAC
TGTCAGCACTTCTAGAACTCTAGAACTGCCAAATACACTCCTTaagcagctggaagacgctTTCCATGCTTTAATTAAGGAGCGTCTGCCCGCCCTTTAC
TTTGATACTGAAGATCCCCGACCTTTGACACGCTTCTGACGCGCCACTCGTGGAGGACAAGCACAACCTCACCCCATactgtggctgctgcaaagcatgc
ttctgcacctgctagtgtcgttggtgctggtgtgctgCACTTCACCTGTGACTGAAAGCAGCGGTCAAGTCCTTTCGCGTTCAGGCTGCGCATGCCAATC
CACGCTTTTGACTGAGACACACACGTATGTTACTTGCTATCagaagagctccagctccacgttgGGCTGTGCTGTGGACCCTTCCGACCCCTGTGCCGAC
GGTGTCGTGGACCGAACGTGGGATCTCTGCAACAGTAAGTCAGTCGGTTACCATAGTGTCCCTAGTGCTTGCTTCATTCTTACATAACTTCTGTACTGTT
CGTGTTTTATTAGTTGTCGACTTGTATCTCGTTACAGATCACAGTTCATCAAGTTTCACGTCGACTGGATCACTTCATGTCACTTTGTTCGGTGACGATC
AAgttgtgctgcagacgacAGAACTGTCGAGTGAGAATCTCCACAAGAGGATTTCAAAAGTTACTCTTGCTCTGGATAGTGAAGCTCTAGTGAAGTCTGT
CAAGGTACGCGGTTCGGATGATAGAATGCGTCGTTGATAGTGTAATTCACCAACTTTGCCCCCTTGTATTCAATAGATTGGAGCGGCAGTTAGGATATCG
CTTCGGATATTCGAAGTACAGACCACAGTGAATGAGTTGCCCACTACGGTATTTTCTCCTCCGACACCTGGGTCAATTACCTTCGTGGACAGTGAAGACA
CAACAAGCACCGGTATCGTGTCGCTGTGGTTTGTGCCTGTGACGGAATTCATAAACGGTCAGTGATTTATAGAGCTTGCGGCAGTACACGACCGAGGTTT
ACTAACATGATACGATTGCTGTCAATTAGGTGATATCCTAAGCCAATGCTTGTTTGACTTGGTGGGACGCTGCGGGTATCATGCCGACCTACAGAAAAGT
TCCGACCTGCTCTTCCTAGCGGAGGAGAGTAATGAACTGATTGTGGCCGCCAAGTCAACTGCCACAGCATCATTTCGGCGACTAAGCGAGCTGAAGAAAT
CTCCGGCATTTATACCGCGCTCTCTTTCATCATTTCCTACAGTGTCGAGTCGTCCTCGATTTCAGCGGACTGCTACATCTAGCTTACATCTGGGTGTTAC
GTTACCAAGCGAGGACACGATAACTATTTTGCCGAACCAACCTGTTGAGGTTCGACTGAAGGATGTACTGGCAAGTATCAAACAAGCTGGCCGGGGGATT
GAAACGTTAGATCTTGTGTGTGTGGAAGCAAGATGGAGCACTACGAGCGCGTTTGAATATGCACAGATTGCTGGGACTTCTTCGATGGAAAAAGTGGAGG
ATGGGAGGTTGATGACGCTTTGGAGATTGCGGCGTCATGACGCGTTGATAAAGATTAATGTTGTGCCAGGTTTTGTCGGTGAAAGCGATTTTCTAATCAC
AGTCAGCGTCAGAGCGGCAGGAAAAGCGAATCAGTTCTCGAAAAAGTACTTCGCGATTGTCGAAATGGATACCCAGCTACAACCTACGGGTTTCAAGAAC
GTCATCGAACCACAGGCAGTAACTCAATTAGACAACGCAGACACTGATAGCATGAAAATTGATGCTGGAATTGACACAAAAGAAGCTCGTCGGCTCGACA
CTTTAGATACAGCAAGTTCTAACGCCATTGTCGTGGAATTACCACACCTGGCTATCGATTTACATGATGATGCTGCATTCCGCATTTTGGCTTCGGAACT
TCTTCCAAACGTAATGGAAACGAGCTCTGCTGTCTGTGAGACGAGATTTACGATCTTCGCGCTAACCAACGCCATTCGGACGGTGGAATCGCCATCGATA
GGCGTTCAGGACGTATCTGGTACTCACGATCCAATTGTTAGACATCTCTGCAACGAGATTTTGTTGACCAGACTAATGGCTGGTGTCAAAAGCGTCCAGG
CTCAGATGCGCGTGGTGATGACGAATGCCGACGATATTGTGCTTGCTATCGTCAGCATCCCTATCAGTTGGACTGTGATTCCTCATGTCAAAGTATCAGT
TCCGAACCAAATTCTTATTGGAGTACGTAACGTACTAGCCGGCGAGATTTTGGAGCTGACGCTGAAGTACTCCGAAGTCTTGACCAAAGCCACAGTGGAA
ATCTTTGTCAAGAACTGTTCTTCTTTGAATATTCAATCTACaggttctgcagctccaacgAGCGGGGAATGTGGGTTTCTCCTGAAAGacgcaagctcaa
gtaacAGCGAAGAGTTTAGTAGAATTACAATTGTTGAGCGGCAAaatcgagctgctccagtcgctATAGAAGTGATTATATCTCAATTTGCGCAAGGCGT
TGATGGCACAAGTTGGACAGTCAGTTCATCCAACGTGATATCGTACGATCTCCACTTTTGCGAGTTAACAGAGACGAATGGTGGACCACTACTTGTACGA
AAAGAGGAGAAGAGTGATATTAATCTCGCTGCACTCTCAGAAATGATTTTCGGTGCCAATTTACTCGACTCGCTGCTTTTGAAAAGTATTGCATTTGTTT
TGGACACAGCATTATTACCAAACATGGGCAGTCTCTTAATCGACGGAGGGCTGGTTCAAGTGAAGTCATACAATTCTACGGCTTCATTCATTACCTTGAT
TGCAGGCAACGTTGATAGATTTTCGTTCACCCCATTTCATTATGGATCGTTTTTAGTGGATGTGATTCTGGAGTGGAGCGATGTAGGCAATACCAACTCT
GGATGCTTCTTTGCGCGGAACTTTGTGGTATCGGTCATGCCTTCTTTTTCGCAGCCTCTACTCGATATTCCTTACTCTTTTAGCCGAAAAGTCCTCCAAG
GTTCTACAGCTCAAATCACTATTCCAATGATGGCAACTACAAATCCTGACATCGAATACATTTCTCTCACTGTAGCGGTGAACGCGACAGATGATGGGAT
CGTCATCAAACGTGATGGTATTGAATATTATCCTTCACCGGAGGATCAACGCTACTATTTCCTCACCCAACGCGATGATGATATAGATCTTGCGAGACGA
GTCGTCATTTCGGTTACCCCTACCAGTAATTTCACGGGAACTTTACAGTTTGCCGTCGGTGTCTCTGCGATCGGTTTATTGGGCAATGCAGTTCCTTTTG
ACGAACTTGGTTTCGAATTATCGACGATTCGTGAAGTAGAGGTCGAATGGATCCTGAAAACTGAACCATTGGAACAACCCGTCGCTCCAGGCGAGGCTGT
TTACCGAAGCCTCCCAACACAACTACAAGGCAACTCCACACTATCATTTAAGTATCAAATGTCCTCAGGTATGCAACTAGTTTGCCTAGGTATGTATGCT
TGTTGATCCTGGGTGCTAACTATGCATTTTGTGTTTTCAGACTTCTCGAGTATCAGCACGGACGTGGTGTTAAATTCTACAGAGATCCGACGGGTGTGGT
CTAGTGATTCTGCCAGTATTACTCAGAGCGAGTGGAACTATGTCGAGGCATTGATTGATCTCTCGTATTCCTCAACTGCAGAAATCGTATTTCGTGCTGT
GGCTTCGATGGAAGATGCACTTTACTTAAAATCAATCTCGATTCGAGACAACGCACAGGAAAATATGATAGGAAAGATCGAGTTTATTCGAGCTACTGGC
GGTATGATCTACATCGAGATCAACATAGCTAAATCCATCCCAGACCCCGTTATGTTGCGCGCTTATGTAAAGAAGGCGGACAGCATCGAGTCACCAGTTC
TCCGATTCACAGGTAAATCTTGTTCTTGGCTCCATCGTGTTCATTCACCCTTTAACGATTTTATTGCTCCATTAAAGGTGACGACCTGCAGTATCTTGGT
TGCGAGGATACCACGACGTTGTATCCATGTGCAGATAGTTCGGGAATATCGTTTGAGAGTCCAAGTCAGTGCAGAACGTTGTGTTCAGCTGTCGAAACTC
AGCTTCAGTTCACTTCCGATTCGATTGTGCGCAGTGCACAAATGGTCCCCCTATCGATCAACGATGCGTTTACGACCGAATTCTGGGTGTTTCTGGAAAG
GCAAAGCACGAGTTCCagtgaccagcagctcttgctgctttaTGGCACTATGGAAGGAACGCTGAGCATTACGCTAAATAGTTATCTGTTGATATCACGC
TGTCATAACCAACTTCGTGTTCCACATGGACTTCCACTGCAGAAGTGGACTCATGTTGCGGTTGTTTTTAGTGCGAACAACGAGGTGACAGTCTTGATGA
ACGGAGTCAAAGTGGCTGATAGCCGTCTTAGCAAGGAAAATTGCAATGTACCAGCGTACGGCTaccttcaacttggacgaggTACGAGATTGAAAACTTC
GTATAGATAAGTACTTTGCTGACTTAGTTTTTTCGACACGGTATTGTACAGATACCATGAGTGTTAGGCCGGAGACATCTGTCTTCCAAGGCGCAATGGA
TGAGGTACTACGCTTAGATTTGAGCTGTCTCTATTATTTTGAAGGACTATTGGTTGCTGGTCGCTCACATATTGGTGTTCTTGACACTCAGGTTCGCATT
TGGAAAGTAGCGCGTGACCCAGTAGATGTGTTTGCATCATTCCAGAAGAATATCGTCCACCCTGATTTGATTCTCATTTTACACTTTAATTCTGCCGAGA
AGACGAACTGGTATCCGTCTGGGACAGATGGGAGTGCAAACAGTGTTGACTTTATGGTACAAAATGTAATTGTCACGAATACACGGCCTATCTACGACTT
TGGAAttgctggagatggaagCTGCTACTACAATTTAGTCGCATCCGTGGCTGACGCGGTGTTAAGTACATATATGTGCGATAAGACATGTGGAGATGGA
AGTGTGAGGACGTGTGGGTCCCACACAACCAGTACAGTGGCAAGCGTATATGGAAAAGGTCCCATTGGCGTTGGTGGACTCTCCCCGTTAACAGACTATG
AAATTTCGGTTGAGTTTGTGGCTGAAGATAGCCAAGAGTACGAAATTACAAGACTATTAAtcgccagcacctcgaatATGACCGTCCCTGGGAAAGTGGA
AAATATCAATGTCGTGGAGCTCTCAGACCAGTTGCTCGAAATCCAATGGAGCCCCGTGGATGATGATGGAGGATCCGAAATCGTAAGCTATTTGGTCTTT
CTGAACGGAATTCAGGTAGCTGACACTGGGAATGGGACCATAATCTCGGTGACTTTAACTATCGCACAGATGCAGAGCAGCTATACTGTAACCGTACAGG
CACAAAATGCTCTTGGCGTGGGGCTCAAGAGCGATTCGCTCACCTTAGCAGGTGTGTATAGTGAGCCTACCCCAGCGATTCCACAACACCCAATCACATT
ATCTGTATCTGGAGGAAGTGTGGaacttgtacttgatgaAACGACcagttttgctgctgatgagCTGTCATCCGTCGTAGTAATCGAGCAGCGTGAGTCT
TCTCTCGCATCATTTTCTAAGTCATTCTATCGGATCAATGCCACGATAGCAACCGTCTACAAGCTACGCCACAACACAGTCTACATCTTTCGCCTCAGCG
TTATCAGTAAAAGTGGCGTTCAAAGTGCCTTTGGCCTCCCCATTGCAGTAAGGACCGGTAACAGAGAGAACCCAAGCAAAACACCATTGCCATCGGTAGC
TGGCGTCACAGGTACAGACACGTCAAGTACTACCGCACTTACGTTCTCTATCTCACTGAGTTCTCATATGTCGTGTTCATCGCAGGGGGGTCAATAACGC
TAGTGCTGGAGGAACCCCTCGCCACAGGTAATTCAAGGATGCGGAACCTGACTTACCGCTGAATGCTCACTGAGTCCAAATTTGCCTTGTTTGTTGATAA
TAGGTGGTCTTCCAATCGCACAGTACAGCATTTTTGTTGTTCACGATGACTCATTTGCGAAGCTAACAAGCATCATGGCATCAAGTACTAGTGAAAAGAC
AACCCTTACGGTGACACGCGACGCAGGCGGAATTCCACTACGCCCACTTACGTCCTACACTTTCAAAGTATTGGCATTACAAGCCAACGTCGTCTGCGAT
ACATTGACTGAAGATGGGTTAGAAAGTGACGCTGTGGTTGCAACAACAGGCATCGCTGCTATCCCAGCTCCACcatctcgtgcagctctgcTGTTACTGT
CGGGATGTACTGCATTGATAGCCGTAGTACCTCCAGACGATTTTCGTGGAGCTGATGTTACCGGCATGACTATTGGAGTCTTCTTACCTACAGGGATCTT
GTTTGAGAGCTTTGCAGTCTCATTGTACCCGAGTGAGATCACTGTCCGAAATCTACTGGCGCATACGAGCTACTCTGTGAAAGCTTCGTTGAGCACCACC
GTCGGTGACTCTGGATTTGGTGAAACACTGACGTTTACAACAGAGGATCCGAGTCTACCAGGTAAATTGAATCTGCTCGAAATCGAAAATGTTGGGTCGA
GTTCGGTGCTTGTGAGCTGGGAAGGACCGCAGAATACCGGAGGAGGGGCTGTGTCAGGTAATGTTTTACGTTGTATTCGCTTGTTGTATTCAAATAGTAC
CATGACAGTCGTCTCTTGCTGCCTTTAGGATATTTACTTTACCAGCGTGCTATCAATTCAACTGCAACTCAGAAACTCGTTTACAACGGATCGAGTGATT
CCAGCAAAACCTCATTTCTTGTTGGAGGGCTCATTGCCGACACTCTGTACATATTTTCCGTCGCTCCGGTCAACCAGTACGGGTTGACGGGTCTGGATGG
TGAAAACGCCATCAACTCTACCACATCAGCTCCTGAAGTACCATTTCCTCCAGAAAACGTCACACAGAGCCAAGTCGATGGTGGATACATGGAGTTGTCG
TTTTCGGAGCCGTTCTACACTGGTGGTTTTTCAGTCGAGTCTCTTCAATACTCAGCGTCTCTGAAATCGTTGTCTTCATGTTTTGCTGACGCATCTAGtt
gctctacatgtactcatGCCTTGGATTCCGACGGTTTTATccaagctcttgctgctacTTCGAACTCCTGTTCTACAACAGCTTGTGCTGTTATTGAAAG
TTGCTGTTTGAACGACGGAACCAAATGTGGCATACTAATGACCGAGACAAAGAACTGTGCTGTTGTTACTACTGCTCGAACAGGAATTTGTCGTGTGGAA
GGGTTGCATTTTACCACGAGATACATCACAGCTCTAGCTGCGACGAACTCTATTGGGAAGAGTCCTTACTCCAACAGTATTGTGGTCACCACGAGCAATG
CCAGACGCCCAGACGTTCCAAGACTTGATCTTGGATCAGCTTCAGGAGGTTCGATTGAGTTGAAATGGACATTTCCAGCGGTAAGCGTAATGACGGTTTG
TATCTACCTCATCGTACATCGCCACACTAACGTGTGCGTATTGGTTTTGGTGTTATCAGGACACTGGAGGTGTATCGATTGTTCGAATGTCACTAAGCGT
AAACGGAGATGAACTGTTTGACACTGACTCAGCTTTGACCTATATTCATTGTGGAAACCTTCGGTCGAGTACGGATTACACATACACGATCGAGATTCAA
AACGCGGCTGGGTTTGTCAGTCGAGCAACGTCTTCCTTTGAGACGACGAATACGACTCCTCCAGGACTTGTGACACTTTCTGAGTCTTACGTAGGAATGC
AAACAGCGAAGTTTCTGGCTGCTTTACCATGTGACGATGGCGGTGCAAATGAAGATCTCACTCTCTCTTATCGCGTTTTCCGAGTCCACGAGACAACTGC
GTCAATTGAAGGGACAGCTTTTTGCTGCTCAATCGGACTTTTTGGCTTAGAAGCGTCGACCAACTATCGAGCAGAAGTTCGAGCTACGAGTTCCGCTCTA
TCTGGTGACTGGGCAACGACCAATTTTACGACGCTAGGTGGGATCCCCTCCAGTCCAAGCACTACACTGCTATTTGCGACTCCGACAGTGCTGGGGCTGG
CACTGGTTCCTCCTTCAGTCACTGGTGGTAGTTCGCTTTCACTCGAGGTGATAGCTACCAGTGTCGATACTGGGGCTTCAGTCTTTCACGACTCGTTGAA
CTGTCCCATGGTAGAACTAGGCTACGAATGCCCAGATACGCTGTCTATAGGTGGGATCAATACTACACAAGATGGCTATACACACACCGTATCCGTAAGG
GCTGTCGGTACTGGAGGATCAAGCGCTTGGACAAACCAGACATATGATCTAGACAATGAACCATCGGGTATAGTTGGATTTGTTGATCCTATTTATCGAT
CTGTCGAAGGTGAGGATGTCAAAGTGGAAATTACGCGAATGTACGGGACATCAGTAGCGGAGCAGACACAATTTCTCATAAATTCTGGAACAATTGTTCC
GTCGTGGGCTTGTTCTTCAAACCCTGTTGGGGCAACCTGCTACGCTGACTCAGAGGGCACCAACACAGGTAAGCGTCACGTCATTCTTTTGCTGGTGAAC
TTATTAACCTCAAATAATGTTTTTGGATCCAGGATACATTAACTTTGAGTCTGGCGAGTACACGAAGACGATCACAATTTCATCGTTTGACGACGCAATG
TTTGAAGCACAACCTGTTTCGTTCGGCCTTACTCTGGTCTCATCAGAGACGAGTGGTATCAGCCACCCACAAAGTGAAGTGATATTCGACGATAACGGAG
ACGCTGGGGCTTTGAGCTTTGAGACGTCTCAATTGACTGTGATGGAGAATGTGGGGACTGTGGATATCGTAATATTACGTACTGGGGGCGTTAGTGGACT
GGTATCTGTGGCGCTGACATCAACTATGAGTTCGAGTATCAGTGGAAACCAACTTGACGAAGTCGTGAATTTCGACAATGGGATTGGCAGAGCGGCCGTG
TCCGTGGATATTCGAAGTAGCGTCGAATATGAAACGAGACGCTTTGTGGTATCGCTCGCAAACGCCACAGGTGGCGCTATTGCGGCTAGCAGTAATTTAA
CTGTGGTTGTTAAGGACCAAGGAGACACGAGTCTTCCCGGACGTCCTCGAGTTATGCAAGGATTAACCACGGGAGGGTGCGTCCAGTTGATTTTGCAGCC
ACCGACGTTTATAGGTGGAAGGACTGTGGCTTTATTGCAGTACAACTTGCAAGTTTCTAGCTCGAGTAAAGGTTACCAGGCATCGTATACTACCTTCTGG
AATAGTATCAATGTCTGCGATCTCGACCAGGATACGACCTACGTTGCCAGTGTTGCGGTTAACAATGGTTATGGAGTAGGCGAAAGCCGAAGTATTAACG
CTTCAACTAGAGCTCTTTCTGCTCCAAGCGAAGTCGTCCAACTACTCGTTGATACAATTACTAGCGGTTTTTCGCAGTTATCATGGAAATCTCCGCTTGA
TAAAGGAGGAATGCCTATAAAATCCTACGAGGTTACGATCGTGAACCAAGCTACGAATGAAGAACGAAGCATTGAGGTTCCTGGTTCAGAGCTCACTCTG
GTGATAAGATTTCTGGCTGTTTCTACATGGTACACATTTACTGTCCATGGGGTAACGGGCGGTGGATTGGTAGGACCCAATTTAAGTGTCAGCGCGCCGA
CAGGCAATGAAGCAGTGATACCTCAGCAACTTTTGCCACCGGAACTGATTTCCGCTACTGGTGGGGCACTATACGTCCGCGTGCTCGCACCGGTTGACTG
CGGCGGTTTACCCTTGACTGAATATGCCCTCAATATTGCTCGACACACTGGAGGAAACGTAGAGTATCGTCAATACGAGCTTGGCACAATTCAGAAACCC
TCCTACGACAACCACGTCGCGAATGTCTCCATTTACGGCCTCATATCGAACTCAGAGTACTTTCTTACAGTGTCCTTGGCTAATGCGAAGGTAATGTGCA
GATGGGTATGAGTTTTCTTTCACAGTATTAGTGCTAATGATTTCGTTGTTGTTTCTAGGGATGGAGCCAGCAAAGCCAAGAAAaaaccttcttcaccact
gGTCCAACCCCTGTTAGCGGAATGGCTGCACCATCGGTTGTTCTCGAGGATCCAGGGGAGATAACACTAGAATGGGGCTCACCATTGGACTCGGGCGGTC
TTAGCATCGTTGGCTACATGATGCAGTCACGCTACCAAATTGCAAACAGTTCCTGGTCACTTTCTCAAGTTGTATACGATGACCGAACGTCGTTGGCGCA
ATCAGCATTGATCTCGAACATACTGCCTAATACTGAGTACGCCTTCAGCGTCACAGCTTATAATTTCCGTACATTGTGTCGCCCCAACGAAGATGTGACA
CCAAGTGATGAACTTCATATCAAGACGCAGGACGCCTCTGCTCCTTCACAGCCGAAAAACCTTCGTACGGTTCAAGTGCCTGGAGGTTCTGTCACATTGG
CATGGGATCCTCCTCGCTCGTCAGGAGGTGATGCTTTACTTTGGTATCTTATCAAAGGTGGCGCAGAAGGCAGTCAGCTTCAAGTGATGGCGAATGTCAG
TGCGACTGCCTCAAAGACACTTACGCTGTATGGAttcgctgcttcttcaccgtATGAATTTGCAATTGCCGGAGAAAATTCACGAGGTATTGGATTCTAC
TCGTCGTCTCTGCATGTGACTACGAAAACTATCAGTGCCCCAGGCCCTCCGAAATCATTGCGACAAATCCCTGTTTCTTCTGGTGGGGCAATAATGCTAG
AGTGGGAAACTCCAGATGACACGGGTGGGGCAAAAGTACAGCAATACAATGTACTTCGCGATGGCATTTCAATTGGCGTGGTGATAGCTGTCGATGGGAT
AACGACGTTTCGAGACCAAGACAATGTTCTAGCCGACAACAATTATATCTACACTGTGTCCGCATCGAATGATGTCGTGTCTGGTACAGAAGCTGCTACG
ATCATCGCTCATAGTGCCATTCAGTCTGtaccagctccaccatcgGCTGCCGTTCGACCTGGTAGTGGATTTGTCGTGCTGAATGTGACAGCTTCACCAG
ACTCGGGTGGTATTCCCTTCCTTTGTTTTGAGTTGACGATACTGCGAGGAACAGCAGCCGTCGATGCTTACAACACGTCGGAATCCACCTTCACAGTAAA
CGGGCTCTACGCAGAGACACAATATTCCATTCTTGTCCAGACTGTTAACACTGTGGGCAAAAGTGAGTCTACTATGTTGACTGCCACAACAACTTCCGCT
ACAATCCCTAGTAAGATGATAATTCCTAGACTGGTGGATGTTACTGGAGGCCGCCTACGCTTTGGAGTTGTTTCACCGGCTAACTCTGGCGGAAGTGACA
TTGTGGACTTTGATTTCTTCGTAAACGGAACGCTGTGTGATGTGGAAAAGATCTCTAACACCGAATATGATCTCGTGGGCTTAACCGCACTCACGTTTTA
CGCAGTAAGCGTATCAGCGATTAATGATGTCGGGGAAAGTGATCAAAGCGATCCTCTAGTCGTTACGACGGACATGGTTACAGCACCTGGTGCAGTGTGG
GAGCTGTCAGTGACCTCTAAGACGCATGACACAATTGAAATTGAATGGATGATACCACAAGATACAGGAGGAGATGCAACTGCAGTGCAGTATGACGTTG
AATTCAGTTCAAGTGATGATAGAATCGATCAGGTACCAAGTGCCACTACCAGTTTCGTATTGTCAGGGCTGGATCCCTCAACACTGTACACCATTCAAGT
TCGTGCGACTAATATGGTTGGCGAGGGTCCATGGTCTGCCAGTTTAGTCGTAATGACAGAACCCGTATCGCCTGGAATTATTAACTTTGCAAAAGGCGAT
GTTCAAGTTTCTGAAGGTGATGGCTCGGTAAGCCTCACTCTGCTTCGTACGATGGGAGGATACATGCTAGCAAGATGCATCTATCGTACAATGGATGAAA
CGGCTCTTGCTGGCACCCAGTACGTGCAATCCAGTGGCCAAATCGACTTTGAACGGGGTATGAATTCCCAGCAGATACAAATCCCGATCATTAACAATGA
TGTGACCGATGATCCAGACAAGTATTTTTCTGTGTCAATCCAGCAATACGACACTGACTCTGGTGCATTAGGCGACATTGATACAGTGAACGTTACTATT
CTAGACgacggagatgctggcgtcCTAGCATTCAGTCAAGATCGATACTCTGTCTCTGAATCCGTGCCTACACTTACTGTGGCCATCGTGAGGACACTGA
AATTCAGCGGCGGTGGTACTCTCGTAGTTGACGTAGTTAAAACTCCCGAAAGTGCCGTTGAGGGTGTAGACTACACCATTCCAAGCAAAACCGTTGTGTT
TTCTGACCAACAAAAGCAGAGCTCAGTCAGCATTACAATCCTGAACGATTCATCGTACCAAGCACAAAAGCGTTTCCAGCTGAAGCTCCGGGTGGTCAGT
GGACGAATTTCTGTTGCTGATCCTGCAGCTACCGTCACAATTGAGATCTTGGATGATGGAGATATCTCCCCACCGGGTTTGCCTACCTCTGTTCAAGTCG
ATGCGATATCTGGAGGAGTTGTTAACCTTTCTTGGGTGGCCCCTGAATACTTGGGCGCGAAAGCGGTTGTGTCATTGACATACACTGCGCGTGTGGTCGA
AGTGCAGACTGGTTCTACGCGAGAGCAACCCGTCAAACCTTTCAGCGCTCTCATTTCGCAGCTTAAAGCTCGAACAGCGTATAAAATTGCGATTGTGGCG
AATAACAATTACCTACTGGGTGCCTTCACGACGCCAATATCAATACTAATGGAGGCCCCTACACCTGCATCGAGAGCTCTTGCGGTTCAAGTTTTATCAC
TGACAGGGGGCATGGCAACGTTGTCGTGGACGTCTCCCTTTGACGCAGGTGGCGTTGAAATTGGCAGCTATCGTGTAAATGTGACCACTTCCATCGACAA
CATTCTTGTGGGCACGTACATTGCGAGCGGAAATGCCATATCAACGAACAATCTCTCTCCATTGAGCAGCTACAGCGCGACAGTCGAAGCTATTAACAAG
AACGGCCTAGAAGGAGACGCAAGTTTCGCAGTCCAATTCACAACTACTGCTGCATCGATTCCTGGAAAACCCACCACTTTGGTGATATCAAAGGCAACAG
GCGGCGCATTGTTTGTGGATATGGCATCTCCACTGGATGTGGGGGGTGCCGCTATCTTGAATTATACTCTGTTTATGACAACGGCCCAATATCCGAATGT
ATTCCGTCAAGTTTATCAAGGCCCCGCGTCATCATTTCACGCAACTCGATTAACTTTTTCCACAACTTACACAATGCAGTACAAAGTGACCAACAAAGTG
GTGAGTCTTTTCTTTCTGTTTATTCATATTAGGCTGATATCCGAATACGGTTTAACTTTGCTTTGTCGTATGTACAATTATTTTCCATCTCCAGGGTACA
AGCGACCTGAGTGATTTGTTTGTAGCAACCACGAAATTTTTATCACTTCCAGACGAAGCGCAAAACCTGGTAGCACTGTCCCGAACTGGAGGATCTGTCA
CGTTATCTTGGACACCCCCTGTGGATTTTGGCGGAGCTGATATTACAGCGTACGATGTATCATTTTTCCTTGGATACGAAGTGAAGTCTCAGTTCCGACA
AAGAGTATCAGGAATTAGTGTGGACGGTACTTCCGTAACCGCAAAAGTGGTTGGGCTTCTTGCAAATTCCACGTATGGGTTTTCAGTATCCGGGGCCAAC
GACGTCAGCATATGTGCAGATCCTTCTGCTCTACTCAGTCGTACGATTGTTTATGGTAGCACCGATCCGTCGATCTCTCTGCCAGATACGCCTCGTGGTC
TTGCAGTAATTTCGAGTACGTCCGGGATGCAAATCATACAATGGTCTGCTagtgaagacgctggcggcGGCTTGTCTGTTGCGTACTTACTGTATTCAGA
CACCGGTGAAATTCTGTACAACGGCACGAGCGTATCATTTACGCGAGGATCGCTAACTAAGAACACAATGTACGGCTATAGCGCTAGCGCATGGAATCCT
GCTGGAATTAGCGTCCAGAGCCCTCGTGTGTTTGCGCGTACCAAAGTGAGTATCGTCGCGCCCAGTCAACCGCTTCTACTTGCTCAGACTAGCAGCACCG
GTGGTTCAATTGGTCTAACATGGCAACTACCCTTGGATAATGGCGGAGACACAATCTCGGGATATAAACTTTATCGTAGTAGTGTTTGGAGAGCTGACAT
CACAGCTGAAGGTCGTACGTTGGTATATCTGGACGATCAGGgccttgctgctctgcaaGAATACGTGTATGTTGTTCACGCGATGAATTCGCTTGGACCT
GGCGCCATGAGTGAAAAACTCGTAGCAAGTACAACTAGTGCTACTGTCCCAAATCCCCCAACTCGTCTTGATATCGTTGCAAACGGTGGTAATCTCACTG
CGACCTGGATACCTGCTGCAAATTCGGGAGGCATTCCGCTGACGTTTTTTCGTCTACAAGTGCTGATTGATTCGAGTATTGTGTTCACGACGACTACGGC
CCAATCACAATTGTCCTACACGCTTTTTGGCCTTAGAGCTAGCACTACATATACTATTATGGTGACTTCTGGAAACGCAATTGGGGGAAGTTTATCGACA
ACACAAGTTGTGTCTAAAGGAACGGCTGttcaaccagcagcaccgccagctcctgAGCAGTATACTGCATCGACTGGATTGCAACCTTGGATGGTCGTGC
TGAAAATGTACCTTCCAATTGATGATGGTGGGGCTCCAATAGATCAGTTGTATATCTATCAGAATGGATTGAACATTCGTTCTAGCTCGGTGAGTTCATC
CAATCAAGCAGTACTGGGAGACCCAACGATGCGCTCTGTACTGGAGGAGATAGGTCCGTTGCATGCAGGTTCGGTGTATTATTTCGCAATGTCGGGGGTT
TCTTCCGTTGGAGAGGGTGCCCGAAGCGATGCAGTGAAAGTGGTGACAAGTCCTGCAACACTTCCCTCGGTACCTCTCAATGTTAACGTGGCACTTCGGA
CGGCATTTTCAGTTGTTTTACAGTGGGAAAAGTCAGTTGATACTGGTGGAGACGATGTCGTCTATGAGATTGCTTATACCGACACGAACACTTCAGAAAC
TGGCCAAACGGAGGTCAACACTACGGCGATTGAGATACCAAAACTGATCCCGGGACATATTTATTTATTTCATGTGCGTGCTCGAAACTCAGCAGGGACC
AGTGCGTGGACACCAGATCTACTAGCCGAGACAGACGTGACCCAACGTGGTGTCATTACATTCAACGTGGTGTCTTCGACTGTGTTTGAAAATGTCACGA
GTGTGACGGTCCAGTTGCTTCGTGTGAACGGTTCTTCCAGTACGATTACCTGTAGCTACACAAGCGGTGCGGGCACAGCTGTGTACGGACAAGACTACAC
GTTACCTCCCGAGGCAGAGCGCTCTTTTTCGTTTGTCGGAGATGTAACAGTACAAAGTTTCGAGGTGCATATCATCAACAACGACCTATACGAGCCAAAT
CCGCGGACAATCAACCTAATTCTCACTGACACAACTGCTGGTCGAAGTGATCCATTTCCACCTACGGCTCTTATTATCACCATTGTAGACgacggagatg
ctggaaTGATCGGATTTGTTAACAGTGAGGTTGCTGTATTGGAAAACGCTCGCATATTAACACTTCAACTCCAACGGCTTAACGGGAAAAGCACCGCAAC
AAGTGCTCGAATCGTGCCATTCGCTGGCCTCGCTAGTACAACACAACCCGAGGTTGGCTTTCGATTACCATCAGCTACAGTGGACTTTATCGATGGCCAG
ACCTCTTGCTACGCGAGTATTGTGATTAAGGACAACGACGTCTATGATTTTCCGGACCTGTATTTCTACCTCACTTTGGAAATTGCAGCAGGAGCGGCTC
GGATTGGGGCAAATAGCGTGATTCGAGTTATGGTACAGGATGACGGTGATCGCTCTGTGCCAGGACCAATGAAAGGACCAACGCTTGATAAAGCAACAGG
TGGGATGCTGAATCTTACGTGGGAACCTCCTGTTAATGTCGGTGGCCAAAATCTCTGGATTACTGGATACAACGTTTCAATGCGCGGTAACAACACTGCT
AAGTGGCTAGTCACACAAACGAATGCTACGATACTACCTTTTGGTGGGTTAAGCGTGCTCAACACGTATAGCTTCATCATTTCGGCTATCAACATAATTG
GGCGTGGATCTGAGGGCCCCAGTATGGCATTTACGACAACAAATTTTACCACGCCCGGGCCAACCGCACAGATTACCTTAGTTAATAGTACTGGTGGATT
ACTTACCGTAATTGTAGCCACACCGATTGATACTGGAGGAGCTTCTGTGATCGGATACGTGCTGTATCtggcagaagaaggcggggATTTCAAGGTTTGA
ATAAGCCAAAAATTGTTGTTGGTGCACCTCAGGTCGAGCTCACGTGTTCTTGTTTGATTGTGCAGATGGCGTACAACGGCACGGGACAGCCTTCATCGGG
GACCCCAGTTAGCGTTAGCAAATCAAATACCAGTTACATGATACGAGCACAGGTTTGTTTGCGCGTGTATATCTGCTAGCTTGTGTGTGTATGAGTGAGA
GACTGACAACACGTATGATGCGACAATAGGCTATCAACTTTGTCGGAGCGGGGGACATGTCCGACCCGTTTACATTTCTTAGTGGGCCCCTATCACATCC
TGGACCACCCAGACTACCTGCTGTACACTCCTCCCGTACCGGAGGAGCACTATCGCTAGCGCTTCAGCCTCCAATTGATACAGGCAAGTTCTATATTCAA
ACATGGCTGCTGTTCCCTACTCTAATGCTATATTTTACATAATGTTTTACTTTGACAGGTGGCCACGAGAACATTTCCTACATCATTTACTACCGCGAAC
AAGGCCTTGGCAAGAGATTTCGTCAGGCTTATTATTACGAGGAGGGTCTCGACATTACTGTGTTCCGCTTAGCCGCGGATACAGCCTACGACATGGTTGC
AGTGTCGGCTCTCGACAACGATACTCACCCAGCCACTTGGGGAATTGTTTCTCTTCCTGATTCAACTATCACGCTTTCAGACAACGTGACAAGTGACCTC
ATGAAGAGCGGGTACTTTGACTTTGGCGTGAGTTTTGCTTACctgttttttgttgttgtatttCCTTGGTCACGACTCGAACTAACATTTTGTTTTACGA
GTTCAGGGCTGTATTTTCGAGGTTGACTCTACGCAAACTCAATCAAACAACACGATAACGTACTCGGGTTCCTTGAGTACCGATGATGGAGCTATAGCCA
CTACTGACCTGCAAAATGGTGACGAGTACGAAGTGTTTGTGCGCGGGGCCTTTAGTAAAGTGACGAACTTCACCACAGCGTCCCCTACGAGACCAGGAAT
ACCGCCCGAGCCCACAAGTGACTATGCGACCGGCGGGGCGATTCATGTGCGCATTTCCTGGCCAAATGACACTGGTAAGTTCATGATTGAGCTAACCGAA
AGAGAGTGAAAACTAACACATGCAAAATTTCGATACGACCAGGCGGGATTCCCATTACCGGCTACGAGTTTTACATTGACAACAAAACGGTAAGACGTTT
AACATGCACACCTTTGTTCAGCGATGCATTGGACTAACATCGCGTTGGTATCGCAGGTGGAAGGAACGTTGTATAACTACCTATCGCAAGGCGATTTCGA
TCTTGACGTTACTGTGGAGATTGGAGGTTTGACTCCTGAAACACCCTACGACTTCTACTACATCCCGGTGAACGATGCATCGGCGTGCCCTGGCGCAAAC
CAAGATCTTCCAGAAGAGATTACATTTTGGACAGACGTGGCGTCTCGACCAACTCCAATTCAGCTGGTACGATCAACAGGAGCCACCGGTGGTGGAATTC
ACGTGGAAGTGACAACGCCAAATGACAGAGGGAGTGACCAGGAGCTGTATTACCAGGTATACATGAGCCCAAGCCGACAAACGCCAATTTGGGAGCTTGT
GTACAATGACACCGACATCTCGTACTGGCAGACTAAACTCCAGAAAGTGACCGAGTATTTGTTCATGGCAACATGCATGAACGAAGTTGGTTACTCCAAC
AATTCGTCAGTTTTCCCGCTCCGAACGACTCTCATATCCCCCCCTGGTCCACCGAGCGGGTTGACCTTTCTAAACGCCACAGGTGGAATGGTACAGCTTT
CGTGGAAGAGTCCTGACGATGATGGTGGAAGTGTGATTACCTATTATTCTGTGAACGGTAAAACCATAATTGGCGATGTCGATCTGGCAGCGGAGACAAC
AACTACTAACATAAGCTTCGGAGGGCTTCTTGCAAGTAGAGAGTACGTGTTCAAAGTTTACGCTGTAAACAGCTTGGGAACAGGATCGGATGCTGGAATG
AAACGTTTCTCAACCACTGCGGCTACTTTGCCGTCGTTACCCGGCGTACCGGTTGTCCTACAATCGTCTGGAGGTGCTGCTACGTTAGCTTTTCAAGTTC
CAGAAGACACAGGAGGTATCAAGCTTGACGATCTAGTGTGGAATGTGTATGCAAATGGCGTGAAAATCCCGGCAGATTCTGTGCGCCAACTGCAAACTAT
ACCCACAACGGTTGCAGCTTCTAAGTCTCGTCGTCTAATGTCAAGGCAGCTAGCCGCGGACGAGGGGTCTTTAGTCTATCTACAAGCTGGAGGGCTGCTA
CCATCCACGGTTTACTCGTTTACGATTCAAGTATCTAACGACGTCGGAGCAAGTGAAATCACTAACGCAACCACGAGTGCGACCTCAGTGGCTACTGTCC
CAGGGGCACCAGAGCCGCCGACAGCAACATTGATCACGGGTGGTGCAATTGAACTGTCATGGTCCGACCCAGTCGACACGGGTGGAGTCCCATTAACCTC
GCACCGACTTACAATGTCAAGATTGGGCCAGCAAGTGGGGAACTGCGAAGGGATGATTCTTTTGTGCACTATCGGAAACCTGTTTTCCATTACGGATTAC
ACAGTCATTCTCGTCGCTCGCAACCCCATCGGAGTGTCCCCACCCAGTACTATTGTCATGTTCACAACGGCTAATACGACACTTCCTCAAGCTCCTCAAA
ATGTCCACATTGCGGAGATGTCAAATACTTACGTCACGATCCACTGGGAGGCATGCGTTGACTTTGGCGGTGGCTACGTTGAAACCTACAAGGTGGATGT
CGTACAAACCTCAGACACTAGTATTAAATTCTCCGACAGCGTCCCCGTGGCTCAGGAGAATGGCACTATCGACGGTTTGATCCCCGTAACAGATTATACT
GCGACGGTGGTACGTCTTCTTACGATGGCGTTCTGGAGGCACAATGGCTTAACTGTTTGTTATTATTTTACACAGCGAGCAGTCACTGGTGATGGCCAAC
TAGGAGAAGCTAGCAAGATTATATTCTTCAGGACACCGCGTTATCCCAACCAGCCTCGACCACCAGCAGTTGGCTGCCGTAAGGAATAttttgtacttct
tgaacagTTGAGGCGTATTGTGTAACCTTTTACCATTGTTTTGTAGATTCACGTAAGCTGGCAATCGTGTTTTGGGAGGCGGAGGATGATGCGATCAGCT
ATCTTCTTTATCGAGATGGGAACTCCCATCGTGACAATGGCCAAGACATCACATACGAGGATGAGATAATACTGGGCACAACATATTCCTACCAAATTCG
AGTGGAAAGGTCAGATGGCACTACCAGCGATCTAAGCGAAGCAACCACATTTGTCGCCACGACCCCAGTATCAAGTGATTTCGATTGTGTCGGCAACAAA
GGACATATCCACTGGCACGATTACCACAACTCAGATATCGAGACTTGGACAATCACACCAGACAATCAAGCGGGTTTATCGATCACTGTAAGTCTTCACA
CGTCATTGTGTTTGTACTGCGACTCAAGTGTGTGAAGACTAACGTggtttttgttgttgaatACTGACTATCTAGTTTTCGATGTTCTGGCTCGAGTGTG
ATCACGATAGCTTAACTATCAACGCGATAACAAATGGGGTTACAAAACAGCTCTGGAAGGGGGGATGTCACCGTGAAGGAGACTTCGTAGTGTCAACTGC
TCCTGGTATCGATAGCGTGACACTTTCGTTTGCGTCAGATGAGAGCATCTCTTACGAAGGGATGGCGCTACACTATGAAGCCGTCGATTCATCCGATGCC
GTCGAGTCTGTAACAGTCCCATGCCCAGTCTCCTCCAGCGGGTTTTGTTCATTGAATGGTGCCTGCCGGAAGGGTTCTTGCTCATGCTTCAGCGGGTATG
TGGGCGAAAGCTGCACCAATGCAGCCATCTGTCCCAAAGATCCGACGACGTGCACATTGTCGACATGTGACCCAGTTTGTTTCCAGTCCCAGAATGATGT
GATTGTGGTGAGCGTAAACGGAGATGACACACAAGGAACGGGGCAGCGTATGGACACCTCCGCGACTGGAACGGACCCTAAAGCGGTTAAGTCGCTCCGA
CGTGCTCTGGAGCTCGCGAAATCCAGCCAAACAATTTTACTTTATCCCGGCATCTACAGTGGAGTTGACAACTGTGGTGTGACTGTGGCAACCGATAGCC
TTCTCATTCGAGGACTGCGAGGTCAAGCAGTGACAACAATTGATTGCAAAAGTTTGCTCCGTGGCTTGATTATCACGGACGTGTCAGTTCAGCTCGTTGG
CTTCACGCTACAAAACGCTGTTACGAGTACTAACGGGGCTGCAATTAGTGCTTCGAGCGCAGTCGTTCAAATGGAATCTATCAGCATCGCTAACGGGAGT
TCTAGCGAAAACGGGGGAGCCCTTTACGCTTACCAATCACAACTAACGCTCACCTACTCCGAGATAACGAGCTGCTCTGCAGTCGCGAAAGGGGGTGCTG
CATACTTGGATGGATCAAGTCTGGTTCTTGATCATTCGATTATCAAGTTATCTTCAGCAAGTCAAGGGGGTGCCATATATGCGCAAAATAGCGTAAGTGT
ACGCGGTGACGATGACAGCAAGATTTGGAGTAACAATGCCACCGTTAACGGCGGCGGTATCTGTGCAGCTGGGACATTCAGTGGCATTAAGCTGAATATT
TTACAAAATACTGCGCCGGTGGGGGCTGGAATGGCAGCAACTAGTGGGAGCTCTACATTTTCACAAGTAAACGTTACCGAGAACCGCGCTGTTAACGATG
GTGGCGGTATAGCGCTACTAAACACAGCAAGTTTGGTGCTACAAAACTCCCCGATACGTATGAACCATGCCGAACGTAACGGCGGGGGAATTTACATGGG
GTCAAATGGTACTTTTGAAAATAATATGGCATCGGAGATTTTCAATTGCACAGCAGGTACGCGGATAAATTAGAGTTTAAACTGGGGTCGCATGAGTTTG
TTGTACTGACGATAATAGTTGTTTGATGGGTCAGCTTCTGGTGGAGGGTTCTATACTGGTGACTGGATACGTGCAACAGTGAATAGCCTTAATGTCCGCT
CGTCTTCAGCTATGATGTCAGGAGGTTGCGCTGCATTTTCCCGCAGTTCGGCAATTTTAAGTAACGCACTTTTTGAGGGATGTGATGCACCTATCGGAGG
TGGGGCGTACGCTGAAAACGGGAGTAAAATCTCTATGCTGCATGCTTCGATTGTAGAATGTACAGCGACAAGTGGAGCTGGAATGTATATCCATTCGAGC
TCTGTCACGGGAGCTGACGATGGTTCTAACTCCATTGTTCAAGACAGCCAAGCTgaaactgctgctggagggGTATTGATTGGCGGGACCCAGAGCTCAA
TCCAGTTTTTCGACGTGCAGAACTGTTCAGCACCTCTCGGAGGTGGCATATTTGCACAGAATGCGTCTTCCGCAACGATAAACGCTGTTAACATTTTCAA
GAATGAAGCAAGTGAAAACGGTGGCGGAATTTACGCTCATTCTTCCACGATGGAGGTGACAAGTGTCACTACAACTGACAATGTCGCGGtagttggtggt
ggagtgTACGCTATCGATTCAAGTCTTTCGGGTACCATTTCAGTTAGTGGGAATAGTGGCGAACAAGGAGGTGGAGTTGCTACGTCCGGTACCACCACGG
TGGATGGAGCTACCATCACCTCAAACACTGCCACGCACAGAGGGGGTGGACTATCAGTTGAGACTGGCGTGTTAACTTTGAAGTCGACTGCAATTAAGTC
GTGTTCTGTTGTTCAGGGTGTCGGCGGAGGTATCTCAATCATGAGTGCGGATGTAAAGCATTATGCCTTAACCGTTCAATCGTGTTCGTCCCTACGTGGT
GGGGGAATTTACGCGAACGCATCAGCGTTCTACCAATATCCTAGCGAAGAGAGTACCGGCATGAGTGAATACTCCGCTTCCCTGATTCAAAACAGTGCAG
ACGAGTATGGAGGGGGCGTTTTCATCGACGGTGAAGGAACGATCATCAGCGACATCGTAGTCACCGACAGCAGTGCGTTGTTTGGTGGTGGACTTGCCGC
TCTGGATGCCCAAGCATGTGTCGCGGTGAATGCGGATATCtctgcttcgactgcagcgaAGTCGGGAGGTGGTCTCTTTTTCGGATCTGGCTCAAATTGC
GTGCTACGGGATTCTTGGGTGACCAACAACCAAGCTGGACAATCTGGTGGAGGTCTTATGGTTCTAGAAGCTACTCTGTATCACTCCAACGTGGAAATTT
CCAACAATATGGCTCCAACGGCAGGTGGAGTTCATGTGAATAGCATATCGCTATCAGCGAGTTTCTTGTGGTGGGATGACGTTAGAACGAAGCGATCACG
TATCGACGCTAATGTTGTTGATCCGAAGGGCGGTAACGGCGCAAATGTCGTGCTTAACTGCACCAGTGACTGTATTCTAGCAGGCTCGATAATATCTGGT
GCTAACTTGGAACTTGggcaaggagctggtgtATTCATAACAGGTCGCGGCAGCTCAACAATTTCGGACTCGCTCGTTGCTAACAATTCCGCTGTAAAAG
GCGGCGGTATTGCGGTTAGTGGCGCTGAAATGACTACCCTTAGAAACGTGGCGGTTGTGGGGAATGTTGCAAGTGATAGCGGCGGTGGTTTATGGGCAGA
TAGCCTGGAATTCTTCCCGGAAGTGGACCTCCTAAGTTGTGTATTTTACAACAACTCAGCAAGAACTTACGGAGGGGCTATTTCACTGTTTGGAGTGTAC
GTGTACAGCTCAGTCTTGCTAGTGGTGGAGAACCATGCAGGCAACAGTGCCTTTGGGAGTGGAGGTGGACTCTTCGCAGAGCAACAAGCTAGTGTTATGG
CGGACACGTGGTTGTTTCTGTCGAATGATGCTACAATCGGAGGCTCCATTGCTGGAATAAAAGCTACCGAGATTAGTCTCATTGAAGGCTATATCACTCG
TGACGTTGATAGATTCTTCACGGAGACGTGGCAAGAGCTGTTCCACAGCCTTGTGGGTTTCAAATACGTTGCAGGACGCGCCCAAAACAAGGTGGGCGTG
CAACAGGGTGATCTCATCTACCTTTCGGACAAAGACTCCGTTTTTGAACTGCTGTCATCGTTCGCGACTTATGGATCGGCAGATGCAGGTGGAGGCATTT
ACGTTAACGCTAATGCGTTTTTGTATAGTGAAGACTCCGAACTCAGTTCCAACAGTGCAGTCGAAAGAGGGGGTAGTGTCTGCGTATCGAACAATGCTCA
AGCCTATTTCGTCTCCGTGAAAGTGATACTAAGCGGTAAGCTACGCGCTCGTTTTGGTGTCACTTGAACCGCATCATGCTAACATTTTATGATGTTTGTT
GTACTTGTAGAGTCCCAAACTTCCGGGGGTGGGATTTATGTGGACATATCTTCAAAAGTTTATGCTGAAAGCTCAAATATATCGGACAACTTTGCTGATG
ACTCGGGAGGGGGGATTTTCCTCGATACGGGAGATAAAATCACTGTCACTCTGAATAGGTCATCGGTTGAACGAAATATTGCGCTTGGCGCAGGAAGTGG
TAAGAATGTTGTAAGATCTCTCGCTTCTTTTCAAAACATTTAGTTGACTTACAGAATAATCTGCGTGCCATTATCACCTTAGGTGTCTTCGTCGGACGAG
AAGCTACTCTGGCTGGATACAAGTCTCAGTTCGCGGGAAATGGCGGTGTGACTTTAAGCGGAAAAAACGAAGGTGGTGGGGCCATCTCTTCTGTTGATGG
TGTCGTGAAGATCACGAGCTGCACTCTCGTGAACAACACCGCAATAGTTGGAGGAGCTATTCACGTCGACCGTGACGGCTCAGCGACAATCATCAGCTCG
ACGTTTACAGGAAATACTGCAGATGAAAGTGGCGGAGCGATTGCGACGGATGTAAAGGCAAAAGCCATAATTTCTTTGTTTACTTCCTTTGAAAACAACG
TGGCAGACAACGGTGGAGCCATTGCAGTGGCTGGCAAATCTACTGCCACGTTAACGTCGGTAGTGTTTCGCCACAACCAAGCTaacgaagaaggtggagc
tgTTCATGTTACAGATCAAGCTACAGTTACAATGAAAGCGGGGGAATTGACCAGCAACAGTGCCGTTTTTGGTGGCGCTCTTTATGCTGACGACCTGTCC
ACGATCAGCATCTCGGACGCCAAGTTCATTAGCAATGCTGCTTTTACTCGTGGTGGGGCGCTGTATTACCAATCTATTGAGAATGTCACGACTACTGGAA
TTACTTGCAAAAAGAACACTGCGCCAAGTGGTGGATGTATGTTCTGGATGTcaatcgacgacgacctTAAGCCTCGATATCCGTGTGCATCTTGCACGAT
GGAGTCGAACTCAGTGTACGACATAGCAACCAATACGCGTGACGTCCATGTGATGTGGTGGCCTGAAAACGTAACCAGTCGTGTTGCTATACTCAAGCCG
CCTGACGAAGAGTCGATCGAAGAGATCCAGACGCGGAATGAAAGCCTGGAGGATACAATGTATGTCTGGCCTCGACTCAAGGCCGTCGATATCTACGGGC
AAATTGAAGTTCTGGACAATCAGACCGAGTGCTTTGTGAGCGATGGTATGTGCAGTGAACAAACCGAGCGATTGTTTTTTGAGCCGCGCACTTCTGTTAG
TGCAGAAATTGGCGTCATCTCCTTTCGCAAAGCTTCTTTCACTGCGGCTAACAGGAcacctgaagaaggtgtTTACACTACAAACGTTTCGTGTACTCTG
CCCCGGTCAGAATCGCGGACTTTCGTCCAAAGCGTAACGTTGTTGCCGTGCCAACCAGGATTCGCAGTTAACCAGGGGTAAGTGCTGTGTATCGTTGCTT
TGTAAGCGTGAACGGATCCCAAAACGCGTGTTACATTAGCTGACATTTAACCTTATATATTTTGCTTTGCCAGTGCATGCGAACGATGCCTAAGAAACAT
GTATAGGTACTAACTAAAAGCAGAGACAGTTTAGTGGATGAGTGATCTGAACTAATTTttctgcgtgctgctgctacagttTGGATGGCGTGAAGTGCTT
TGATTGTCCGTCTGGTGCCAAGTGTAACATGAATGTCCGACGCGCTACGGAAACGATGGCAGCGGAACTTGGTACTGTATCCCCACGCACAGAGGAAGGA
TTTTATTTATTTTCTGCCCCAGCGTCAAAGCACGAGTCGAGCTGTCTTAAGCCTTCACAATGGAAGAACGAGGATCCATGCAAGAAAATTGCCCTGGGAG
AACCCAGAGCAAACCTTTCTGATGTGATCTACGAATGTTCAAACCTCAACGATTTCGACGTGTACTGGACCCCCGATCGACTTTTCTCGTGTCTGTCGGG
AAAATCATTTTACACTTGCGACGTAAGGCTACAATACTGAGGTTTGGAGCTGTTTGTTCTGGAGATTGCAGTTCCTCACATGGGTTTTGCTGTATTTTTG
TGTCATTTATCTAGGTGGAGGGTGCGTGCCAAGCTGATGTTTCAATCCAGACGCTGGCACTGGCAACGACTGTGAACAATGTCTCGTGTGCCAGTGGGTA
CGACCTTACGATTTGTTCGGTGTGTGCTGACGGGTTCAAACGAACTACAGACAATTCATGCCTACGTACGTAATGTACACGTACTTGTTGTGTGATGCTG
ATACTCGGTGATTACCCTAATTTTTTATGCTGATGTCTATGTAGCGTGCGATAAGGCGAatgctcaagttcgagcaTCCGTTCGATGGCAGAACTTTGTA
ATCCCAGTACTGTTGCTTTTGGCCATAGCATGTGGGATCTATGGAGTGCGTCTGTACCTACGCGACCTCACGGAGATCGGTCTGCTTGAAAAAGCTGAGG
CTGATAGACGGCTTAAAGCTCCTAATTCGAAGAGTGGAGAACGCATTACTCAACGTGCAACGATGGCGTATCGGAGACAATCTGTGGTAGTAGTGGACCG
AATGGATCAAGTCAAGGATAAAATCACTGCATTCTTTAAGAAGTACCGGGATCGAAATGCAAAAATGGTCTTCGGTGTGGATGTCAGCCCCCCAGCAAGG
ACGTTCCCAGTAAGCCCAAGCAAGTTTAAGATCTTCATCGGGTTCTTCCAGATATTTGGAAACTTCCAGAGCTCCTTCGTTGTGAAGTGGTCGACCAGCG
TACAAAACATCATGAATTTCTCGCAAAAGTTTAATCTGGTACGCAATTGAGGAATTAGTCATTGTATTTTACCCAACTAACACGCTGTGGTCCATGAACG
TTGTGAGTAGGACTTGGTGTCCATCGCTGGGATCGACTGTGTGGTCACGAAAAACTTCTACTTCGATTTCACGTGTGTTCTCCCGCTTTCGTTTTCTCTG
TCATTCACTGTATGACTAATTCGTGCGTTTATTCGTGTGTTTTTATGTCAGTATCACCGTGAGTCTAGTTGTGCTCGTCCTCACAGTCATCACCGCGTAC
TTCTATGCTGGTATGCGCAGTTATAGTATAAAGCTGCAATTGATTCCTCGCAACTGTCTGCGATGCGGACTCCCAGTGCTGGAAAGCGAAGTGATCCGAA
ATGACGACGAAAGTTTCAACCCTCTTCGCCTGCtgcggagctggtggagaactCATCGTTTCTACAAGCATGATGCATCTGCTAGTCCAGTGGAATCGGC
GAAGAGTATTTCAAAGAACGAAAGATCGATTGCTCTTTCGACGATTAAGGAGACCCGGTCGCTGAAGCGCAAGTTTGGGATGTCACAAGTCCGCACCCCG
TACCTCGGTTTGTTTCGGTCTGTACATACAAACTGTCCTGTGAAGCGACACGTGCTATCTGGTGCGATGCTGGATCGCACGATCCGTAGTAATCTGCGCG
TATGGCAAGCAAGGGTGAAGCTGCGCATGAATTATCTTACGTACCGGAACAAGTGTCTAAAGCTCTACTGCTGGATGGCACTCTTCCTGTACCCGTCCGT
CTCGAAAACAATACTGACAGTCTACAACTGCCAGGAAGTAGGCGACATCTTTTATCTCGTCGCAGATCGTCGCCTGGTGTGTTACAACGGGCAATGGGCG
GTGTTTGGTATGATCGCAACGATCGGAGTCATCGTGTGGGTGGTGGGAATCCCATTCTTCTTCGGCCTCCTCATCTGGTTAGCACAGGACCGTGGCGTTG
CTGCACGTATAAAGTTACTACGTAAGCCGCATATACGTGCACAACGGCAAAAGTGGCTTAATGAAGTGGAGGAACAACACCTAGCAGAAGGGCGATTTGT
TCGAGGCATGGACAACATTGAAGTGCAGGATGAGGAGCTCGCGAAGTACATGAAGCGCAAGAACTTGAGAGTAAGTCACCCCAAACCCTAAGTTGGATTA
GTTGCCATGCGTGAAGACTCACGATACATTTTGTGTGCAGGACTCCACGGTACAAGCTCGACTGGGCTTTATCTACGCCGAATGTAGGCGCTGATACAGA
GATTCATGCTTACCGCTTAAGACTAACAGTTCTTCTACTACTTCTTCTTACAGATACGAACGATTACTGGTGGTTTGAGGTCGTGGACCTCTCGCGAAAG
CTCTTCTTGAGCGGTGTGATCGTATTCGTGGAGAACGGAAGTGTGGAGCAAGTACTACTCGCCCTTGGTGTCTGGTAAGTCTGTGCTGGAAAGAATTTGG
TTGATCTTCGTGGAGGAAAATGGATTTACGAACTTACTGTTGTTCTGTACTCCAATCTAGCTTGATGACAATGTGGTTCCTACTATACTTCCAGCCGTAC
GATGGCTACTCGGACAATCTCATCGCGAGTATCGCCCAGTTGCAGCTTTATTTCACGTTGTGGCTTGGAGTCATGATCCGTCTGAACGACGTCAACGCCG
AGTCGCTGATCAACGTGCAACTGTTGAGTTTCCTACTTGTAGGAACGTGCATCGCTGTTACTGTGTTTGGCTTTAGCATGATCATCAGCGAAGGCCTTGC
AGAATCACGAAGAATATTCGCTGAAACGACAGCTCAGCGCAAAAAACAAGTTCAAGACGAGACTCGAAAGCTGTGGTTTAAAGCGTTCAACTACGCGGCC
TACGAGGCACAGATGCTGCGTTACGGCGGCCAGTTGAGtttcaccaacttcagcgTACCCGCAATGCTAGAAGCTTTCCGTCGCACGAAACTCAtggacg
aagatgaactTGAAAGCGTCACTGCTATGCCCAAAattgaggaggaagaacTTGAGCTTTCGCCAACAGATTTACGTCATCCCGACAAGAGCACGGCTCG
ACAAGAATGAGGAGGATCACCGATAACGACAACAGGGTCTCACCAGCTACTCAGCGGACAGGCCAACGTGAATATCAACCACGATGCTAGCAAGCAGTGT
CGAGTGACGTACCTATATGTACAAACCAGTGATACCATCTGAATATAAGGGCACATTTATATTGATGGCATCGCTAGTGTCCATTGCTTCGACCCTGCGG
CAAGGATCCTCAATCCACCATTTGGTAATAGCCGAACTAGTCGACGCACTGTTGCGCGTGAGGTTTCAACGCCGTGAGTTTGGCTGGTTAGACGATGGGC
TGCCGCCCATGCCATAATTGCAGATCTGGCATTCCTGAGTTCGCCAGTGGTATGCTCCGTTAATGACGTCAAACCCTACAGCGAATTCAGCACAATAGCG
GTCGTATAGAGCTTCCCATTCGCCAAACGTTACGATTTCGTACTGGCGGGCAGGCGTGGATCCGAGACTGCATATCAAGGTCAAATTACATTCGTGAGTA
ATCAATCATATCAGCGGATCATCTACTGACACAACTTACAATTGCGTGGCCTTGAGTGACTGTTCCAGCGAGAATCCCGACAAGAACATGGAAATATACG
GCGGCACGATCGTCCTCTGATGCGATAAACACACCAACTCGGCATTCAGCACCGGTCCAGGAGCTCCATCCCCTTGACTGCGTACAAACTTCCTCCACTT
GTTCAGCCACTTCTTGGGCACCAAGAAGTACGTGGCGTACTTGCTTCGTCCATTCAGCGACAGATGCGGCGccaattgctgctgtctgcttcCTGCCGAG
TATACGGGGGAAAATAACCCCTTCGGATATCcgttcttcctctgcagcagctccagcatctcttCCGAGCCTGCGATTTCCCTGTCAAATCTcgttctct
tcttctcttcggcCTCCAGCTCCCGTGCCTCCTGCTTCAGCACACACGTCGCGCAGTCGCAGCACGATCTGAGCGTAAAGCCTCTCAACTCCGGGGCGTA
AACTGCGATCTCCCTGAACACGTCCCCACTCAGAATCGCCCGCCTGCTGCGCCCCACACACTGCGCCGCCGGTAGCAGCGCGTCATGCGCACAAACAATC
ATCGCGCCGGCCTCGTTCAGTGACGAATTAGCTGCAATTTTAAGTTTCTCTATCGACACGACCACGTCCTTCTTTTTAGCTGCATTTTGCCGTCTCTGCT
GCCGTTTTGTGCGTCGGAATTGCAGCAAAAAGTGCTCAAAAGCCTGGCAGCGCTTCTTGTAGGCGCCGAGCCACGCGCGActcacgacgacgcagctGGG
TGCGCACGAGGCGGCATCTTCGTAGGAGTGAGCGGCTGATcgagccagcagctccttgatgtGAAGTAGCTCGGCGCCTCGGAGCACGACGAGCGAGCGC
GGCCAATGGGGGGACGAGGACGGCAGGAAGTTCGTGACGGCGCCGAATCGACGCGTGATGACGCGCTCCAAGGCCAGTTGGGCGGCGGGGGTGGACGGAG
AGAGAGCGCGGCATGTAGCGGTGACTTGGCTGACGTCTCGCGCGCACAGGAGCGAGAACAAATGCGCCAAGAGACCATCCGGGAGGTGCTCCAT