Description :
From Genome Similarity Track
Location :
Scaffold_352:30684- 33623
Transcript NameFunction/comments
g11352.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g11353.t1hypothetical protein

Sequence
2939 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAAGTTTCAGTATACTTGCGGATACAAGTATACTAAACTTA
AGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCG
TCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCA
ACGCATGTTGCGCGTGCAGACTGCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGAT
GTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGTTCGAACTTCGGTGTCGCCATCG
GCCACACCGCGCGTGGAGTCATTGAACTCCACGTAAGCAGTTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCAT
TGCGGCTCGACGTATCGTCGAGCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACA
GATCCTACGTGCTTCATCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGCTCCGATCGAGGGCGGAGTTCCTCG
ATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTTGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGT
CGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATCCTCTCGAGGCTGCAATTGCGCTTGCAATGCAA
GAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTAAACGCCCCACGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACC
TCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCAC
AGCACCTGTGCACGCGACGAGGAGCCGTCGTGGCGGTACTGGGTATCGCCACGGGCAATAAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCT
GGTGATGCGATCGAGCGTGTCGACAGCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATTTCACTGCAAGAAGCAAGATGACAAGCCGA
ACCTTGTCATCCTGAAGGTAAGTTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCC
AAGGCTTGACTTCGAGGAAGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAATCGAGAAGCGTATCGTACGCGTA
CGCTTCTCTTACCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGTTTGCACGGC
ATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCACATGCACCACG
TGGTGCATGCGGCCCTCCACCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGT
GGACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGAGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGG
TCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACC
GGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAGAACCGCCGGCG
AATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCG
CAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGATGCGTACA
AGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCACTC
GCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGG
CGCGGACGCCCTTAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTAC
AAGGATGTACTCCCGGACGACATTCCTGCGTAGTTACCG