Description :
From Genome Similarity Track
Location :
Scaffold_36:306829- 322658
Transcript NameFunction/comments
Phyin_T30-4PITG_14572Putative uncharacterized protein
Phyin_T30-4PITG_14573AP-3 complex subunit delta%2C putative
Phyin_T30-4PITG_14574Putative uncharacterized protein
Phyin_T30-4PITG_14575U6 snRNA-associated Sm-like protein%2C putative
Phyin_T30-4PITG_14576Putative uncharacterized protein
Phyin_T30-4PITG_14577Putative uncharacterized protein
Phyin_T30-4PITG_14578Phosducin-like protein
Phyin_T30-4PITG_14579Putative uncharacterized protein
Phyin_T30-4PITG_14580Putative uncharacterized protein

Sequence
15829 bases(100 bases per row)
GACGTTGTACATTGTTGGTTCTCAAGTCATTTCGGCAACAAAACAGTGCAAGACAAGAAGACGTTGCCGGTCTCAAGTGCAGAACCCTGTGCTCTTCCTA
GCTCCCTGATCTACACACAACCAGGAATCCCACACGCTTAAAGACTTGTCTACACAAAAATCACCTACAGAAATCAAATATGGCGCCCTCCAAGCGATTG
AATTTAAGCAAGTCGCGTGACGACGACGAGAGCTCCTCGGCCTCGTCCTCCAGTGACGAGCAGGAGCAACAAACAACGACACAGTCAGCCCAGGATGATG
ATGATTCCAGCTCCGGCGAGTCATCTGATGAGTACGAGGCCAACACTGTTGTCCCAAGCTTTACCGCTGAATTTTTGTGCATTACTGACGATGCTGGTGG
TGATGATATTGACACAGTGAATTTGAGATCCCGCCTGGATTCGAAAGCGTTAAGGGCAGCGGCGCCGTGACGCGTGAGGCCGTGTTTAATAACGACCAGG
AGCTCTGGTTCTTCAAGCTGCCTAAGAACGTACGTGGCTCGTTGCAGATAAGCCATCAATTGTCGCTGTTATTGACAATTTTTTTTGTGAATAAATTGCT
TTAGCTGGACGCGTCGGCGCTGGCCAACGTGACGATCAAGGTGGACGAAGGCAAGGCGGCACCTTCACCTGGTGAGGTGCTGGCCAAGGTCACAGCTGGG
GAAGATAGCAAGAAGTACCTACTGCAGAGCGAAGACGGGATGCTCACAGACCAACTCGTTAACGCGCTGCCTCTCGCTTCAGACCGCGCTCGCTTTGCTC
TAGGCAAACCATTCTCTCGTTGTTTCTCGCTCGTGGAGGACCACGTGGACGCAGTGTCCGTACCAAAGGCGACAAAGACCGAGACCTTGGTGGTTGAAAA
ACGCAAGAAGAAGAACTCTTCCGACAAACAGGAGAAGCAGCACAAGTCCAAGAAGGCTAAGCACAAGAAGTAAAAGTCCACAGCACTCGATAGACATCCA
CGAAGAAATTCACCCCCCCCCCCTATTTGTCATTATGTTTTCTTCTCACTCAATGGTGGGTCGTCTAAAAGAGCAGAAGTGGCTCTGCTGGCGGTGCCTC
TGGACGTCTAGAGCTCTTGTCCTTCCTCTTCTTCTTGCTCTTGTCGCCGTCACCGCGTTTATTCGAGCTGCTCTTCTTGCGGCTGCTGCTTTTCTTCGAT
GAGCTCCGTTGATGGCGGCTCACCTGATCTTCAGACTCCTCTTCCTCTTCGCTAAAGCCGCCAATCAGCAGATCCTGCTTCCGCGATGACTTCTTGGACT
TGGAGCTCTTCGACGATGCATCCTTCTTCTTTTTCTTCTTGCTGTCATCGTCTCCACGTGATGATTTCTTGTGCGTGGAGCTCTTTTTCTTCGACTTCTT
GTCATCCTCCGCTGGTTTCGCAGGTGTCTGACGATGGAACCATTGGTCCGTAGGAACCTTCTCGTTCTCACCAAGAGGGATACTCAAATCAACTGCAGCC
AGGTCAGTCTCCTGTTAAACCACAACGAACAAGGAGTCAGTAACCAGCTCGTAACAGCGAATAAGTTTATAAAACGAAGGCAACGTACGTCTTCACCCAC
TGAGCCCCGTTTCTTACGAGCGCGTCGACGGTCTTCGTCGCTTGAACGAGCGCCTTCAGGCATCAGTTCGTCTTCAAGGATATCACGAGACTTCGACTTC
TGTAGAAGCAAAACAATCTAAGCTTCTGCCAGACCAAACGACGCACTTAATCACGCACCTTTGACGCCTTCTTCTTCTTGCCATTCGAGCCCAAGGCGCC
AATCATATTCCCAAAGCCCTGTAAGCAATGCAAAGATACACCGTCAGCAGAACACAACTACCACATGTTGAACAAGGTCGAATTGCTTCTCTCACCGCGT
TGGCACCAGCACCCGCTGAGGCTTGTGAGCCGCCTGATAGATAGAACGGGTCCTTGCGCAGTCGTTCTTGTTCACGCGCATACTCACGCTCCTTCCTCTC
CTTCTCATCGGCAGAGTTCTCGGACTCAGCCTCGGATTCAGACTCGGACGAGGAGTGATCATGACGGCGGTGTTTGTGTCCGGCTTTCCGCTCAGGAGAG
CCGTCTCCAATGCCACTGTAGCCTCCACCAATGCCAGCGTGACCCTGACTAACGAACGAGACCTCAAGATCATCCTCGCTCGAAAAGGCTGATACATCTC
CGCCGGATTCAAGAAATTTCGCCTCAGAATTACTCAAAGGCTCGTCAAGATCCAGGTCTCCAGGCAGTGGCACCTTACGCTGGGCCTTGACACCAACCGG
CGCGAGTCGTTCTGCAAAGTACGAGTTCAATACGTCCAGTCGCTTTGCCGGGTCCAAGGAAGCGCTACCGTCGAACGCGCGTTCAGTCCGTTCATGAGCC
GTAAGTGCCCCCAGGCCCATACCCAACGCAAGTAGAAGCTGCTGTAGACACACTGCACGCTCCTGCACCTCGATATACTCGCTCTGAACGAAAGCAGGCA
AGCGCTCCATGATAACAGTCGCAATGCGCTCCACTGTAGCGTCATCGGCTCGCTCTGCCATGGCAGTTAAGATCTTCAGTAGCGCCTGGATAAACACCGT
CTGCACGTGGCCAGGAAGGGTAGTCGTACGAGGCTGCAGCATCTCATCAGCGAGATCCTCCAGCCGCTGCAGTTTCTCCTCCTCCGTCTCTCGCTCTTCC
TCCTCACTCTCGTCCTCTTCCTCATCATCCACATCGTCCAAGAACTCCATGACGTATTCGCCTGTAATCCAAGCTGCAGCGTAGTAAACCTCCTGCAAAG
TGCCAGCTCCCGGCCCACTGAGCGCCTCCTTCTCCATCAGCAACTCAATCATGTTATCCACCATCACACTGCGCACACTCTTGACTCGAACTGCAATATC
CACAAGCTGACGAGCTACTTCCACGCCATGCGAACGCTTTGCAGGCTCGTCATCCGCCACTTTCATCTTGGAGCTGCTAGAACTGGAGCCCAGCATACTA
CCGGACGACGGAGCCAGAGATGACAGTGACGCACCCACTGTAGCAGCGGTATTACCGGGCACACGAGCGAGTTGTACCAGTACGTGAATGTACCAGTCGA
AATCGTGGATATTCGCGTACTTGTTGACCGAACAGACGTGTAGAATGTGCGTGATAAGCTCGTGACGGTACGCTCCATCGGCGCTCAGAGTCTGACGCAT
GAGCTCCCGGATAATAGGCGCCGCGTTATCCGGATTTACCATTCCAGAGAGCAACTCCAGCGCTCGCATGCGAATCGTGATATCATCCACTGCCAGACAC
TCCACGATGAGCTCCTGGTGCTCCGTAACCACGTAGGGATGAGACTTCATCAAGTTCCCAAGCCCCACAAGTCCCAAGTAGCGCAGATTCTGGTCCGGAT
CTTCGATATAGCGACGTAGATGATCATTACAGAGTCTCACGACTGGCGCAACGTTGCGTGGCTGGGATCCGTCGCTCTTCTTGGTGTACAACAGCGCTGT
CGTGACTGTACTGATGCATTCGTACAGTAGAGACTTGGCTGGCGTGTTCTGGATGACTGTAGCCAACGGATCCAGCAGCTTTCGAGCAAGACGAGGCTCC
TCCGGCACTAAACTGGCCAGCAACTTGACGACCTTAATGAGCATCCAATTGTTGGACGAAGTGGTGAGTAGACGGAAGAACTGAGGCGCCAGACCCAAGT
AGTTTTTGGGTTTCTTATTGGCCAGCTCGCAGATGACGTTGACAGCGCAAGACACGACGGTGACGTCGGGCTCCTCCATCCTTTCCTTGAGTCGGTCGAA
GGACAGTCGGAGGCCTTGAGGGTAGCGAAGGAACATCTTGTACAGCACCAGTGTGGATTTCTTACGGACGTACGGCTTAGGAGAGCCCATCATGGCTAGT
ACGTCGCCCAGAAGGTCTCGAGCCAAGTCCGTCGTGACGATATTTGCCAACACGTTGATCGCCAGACCCACTTCGTACTCGCTAGTGCTACCGAACTCCT
TCTTGAGCAGATTTGTACACAGTAGCACCACATCTGTGGACTGTGGGAAGCTCTTGCATGCAGCGTTGTAGCCGATACGTTTGTGCGCGAACCGCTCATA
GCTCATGACCTCCACAACGTGGAAAGCAGCCCAGCACATGTCGTAGCCCAGCATATGCAGGTATGTGAGCTTACGCACAGCCTGTGCCTTGATAAACGGG
TCAGTACTGCGTAATTCCACCTTGATCTCCTGTAGAGCCTGCGAGATGTACACAGTCACGTCGCCCTTGGCTGAGCGGATGCCCTTGACCAGGTCCTGCA
GGTTCTTTTCAAACATGGCGGACGATGTAAGCAGCAGTGGGCGGCGACGAGGACTGCAGACGGAAGCTGAGACGCGAGGCTTGCAACAGAGACTACAGTA
GACTAGCACTCGGAGACGAGCTATAGACGCCAAACACGGAGCGCCAGCAGCAAGGCGATGCCCCAGGGATGCGAATCAAGAGCTAAAGTCGGATCGCAAG
GGGGGAATGAAGTTGAACCCGGGTCCATGATTTAACTTGAATTTGTAAGGAAACGGGTTTCGACCCGAAATCTTTGGTGACTTGGCTACGTTTGCTGTCA
ACCTGATCTGCAACGGCGTCGATGTCGTGTGAGAAGCTACTTAGGACTGCATTAGGCAGATTTAGAGGCATTTTAGAGGCATTGTTGCTTCATTCACTAT
AAGTTCACTTGTTGTACGCACAAATTCAAGTCCACAACTGACTGACACGGAGAAAAACGGTAGTTGCTATTGTATTCATCTGCTGGCACTTGGACTTGAC
AAGAGACTTCAGCCCATGATGAGTTCTAGCACGATCATGAGTGTGTTAATAATCATGAGCGGGACTGCAGTGGAACGTTGCGGATATCGAACAAAGAAGC
ACGAGAATTAGCGCCACCATAACATTTCGCAATACCAGCAGAGCAGCAAGCAGCGTGGCCAGCCACCAGACGTACATCGTAAATATTGCACAGCGATGAG
GAAGCCCACGATCTGGTTCTTGATCGTCATGCCCTGCGACGAGTCCACCTTGTGCCATCCGTCTGAAGTCGAAACAAAGGTCAATAGAGCACTTCTACAG
CAGACCATCACGACCGTACGTACGCGGACGCAGGAATCGCTTTTCGTGCAGGATGCACACGGCATTGGTGAGTAGCAGGCTCGTGAGCACGAAGTTCCAC
AGCACGCCCATATTTTGCGAAGCTCCTTGACAATGACATGTGGCGATAATGAGACTATGTACCATCTATTTGGTACAAATGCACAACTACTGCTCCGGCT
TGTTGCTGTCAATCCCTGTGCGGCACATCGAGATTGACCCAATTGACACCTCTGCATCTCGCTACGATGGCTCGTAGTAACCAGGTCTCCAGGCGCCCAA
GACGCCACAACAAGTGGACTACATCGGCAGAAGCGAGAAAAGCCGAAGCCGAAGCTGCAGCTCAATCTTCGAACGAAAAGGAGATCGGAATGCTGCCACG
TCTCCTCGTGCGCTTGGGTGTGGCTGGTTTAATGGTAGCAATCGTAGTGCTACTGGTGGCTACGCAGCAGCAAGAGCCGACACCGACGCCTTCTCCTAGC
CGCACATTGAACTCCCATGAAGAAGCGCGAGTCGAAGCGAGAGCCACACGTCGAACAGCATCTCGCCCCACGGTCCAGATGCTGGGTAAATATCCGCATG
ACACGAAGGCGTTCACGCAGGGCTTCACAGTGGTAAATCGCGGCCATGATAAGATTTTCATTGAGTCTACTGGTTTGAACGGAGAATCGACTTTGCGTCA
TGTGGAAATTGAAACCGGAAAGGTGCTGAAGCAGTACGATCTACCACAAAACCTCTTTGGTGAGGGCGTGACAATCGGCCCGAACAACGAATTGGTTATG
CTGACGTGGAAGAGCAAAACCGGTCTCGTGTTCGACCTAAAGGAAGATGAGGATGGCAAAGCCGATGGCTTCGCATTGAAACGCGAGTTCAAGTTTGATA
CTGTGACGGGTGAAGGCTGGGGCATCACTTTCGATGGCGAAGACTACGCGGTCTCCGATGGCTCATCGACTATCATGTTCTGGGACGCAAAGACAATGAA
GGAGGTCGGGCATATTGACGTGTCGATGTACAACGGCGCACAGAAGATTTCCCAGATCAACGAGCTTGAGTATGCTAAAGGATTCATCTACGCAAACGTG
TGGTACCAGCCTTACATCCTGAAGATCGACCCCGAGACTGGCGGCATTGTCACTATGTTCGACCTGTCCAAACTGGTCGCCGACGCTGGCGTTGATGTGT
CTTCTGGCGCTGTGCTCAACGGAATCGCTTACGACGAAACAGAGGACGTGTTCTACCTCACGGGCAAGCTCTGGGGTTTTGTCTACAAGGTTCGTCTGAT
AGACCCCGTGCAATAGGTGCAAAAAGAATAGAATGCGCTGTAGCAGAAGAGCAATAAAGCACGAATATGGATCTTTTGAGATCTTATCTATGTAGAGAAA
CTTTCTGAATAGTCTTGAACGCCGCAGTCCTTCCTATCCTTCCTGCTGTAGGAATGGGTTGGGGATCTCAGCTGTGCCGTCCACGGGAGACACAAGCATG
ACGGATGTGCCTCTGCACACCACTAGACCCACTTTGCGCGTCTCGTCCGTAATTCGGTACTCGTCGCTCGGGTCACGCAGGAACTCGACGCAGTCGTCCA
GCACCAAATTCACCAGTTGATCGTATCCCTTGAGCGTGCCCGTCACCTCGCGACCGCCATGAAATTTAACGCGAACCTCCTGGTCGATGTACTTGGCCAG
ATCCAGGATGGGGTCCTTGCGACTGCCGCCGCCGCTTGCGCCGTTCGCTGCCATCGCTGTTGCAGTTGTATGGAAGATGGGCTCCTCCTCTGTCATTGGT
CAAAAGTTAACAGATGATTATCAGCCTGACGATCATGAGCAGAAGCTTCGTGGCTGATGAGCGCGTGCTGGAAGCCGTGGCGCAGGCCAGCGAACTGTCA
GCCGAGAGTGGGTCCACGTGCTACTTAATGCTTGATTGTTAACCATTTTGATTGCATTTGGTTATTGATGTGCTCGATCTGGATGCAGACTTTGGGGAGA
TATGCAAGCTGGCAGTGCGGCTTTTTGGCTCGGACAAGCAGAGCAAGCGACGGCTAACACGCACAGCATGTGGGTGCAAATAGTGCGGCTGAAGTCAGGC
AGTTGCGTATGGCTGAGCTGGCCTTAGTGTTGCTGATAACAACAACTTGTTATTTGCAGCGGCGTCCGGGTGGGGGGCGGGCCAGTTGGAGAAAGCGGTG
CTCGCCATCGCTAAGGTCCTCATGGACAGCGTTAAGGTGTCTGAAATAGCTGCAACTTGAACGAAGAGATGGCGCGTGCTAGTGCTGATTGTATTTCTAT
GGCGGACTAGGCTGAAATGTCCGAGCATGCGTTTCGGTTGGTCTTGACAGGGATGACGCTGCCGGAGCAGCACATCGACGTGCTTGTTCAGGTATAGCTA
GTATTTTCTAGTGTACTACACGTACATTACATGCTAAACGTGGACAATGTTATTATCTACTCTATGCTCGAACAGCTATATAGCGCACACGGGAACGACA
TCCGAGAGTGCGTATCCAGAGAAAACGGCACAAGCGTTCCGCGCTATCGCAATTTGGAGTGGCGAATCGACGTAGAGGTACGACGATGAGATTGGATGGT
GACTTTGTTTCTGGGTATATGAAAGTAGAAATGTGACACCATCAACTGCGCCTACAATAGCTCGGCACTCGCTTCCATCGCAACAAGCCAAAGCCTATCG
TGACGCTTCGTCTAGACACTGCCACCCAAGCCAATAGTACTACTATGCCACAGGTTCTTTCAACCCGTCTACGCGTAGACTACGACGGTCTCAAACTGAT
GCAGCGGCAGCTGGAGACCGCGTTGAAAGAGGTCGACTCCGTGCACTGTAGCCGCATCCAGCGGTACATGAACTGATCAGCAGTACGATCCACAAAGCAA
ACACACCCACACTCTCTATCAAAGGCCAGAGTTTATTTCTCTTTCTTCCTGTCGGCTAAATACTGCTCTTTCGTCTTCGTGAATGCCGTGACCTGGTCCA
GCTGCTGCTTCGATTCACTCGAGAGGTCATCCTTCTGCAGCAGCAGCTCGGCGAACTTAGCTTGCCTTTTCTTCCTCGTCTCCGCATCCGGCTTAATCTT
GGATTCCTGCTCGGACAAACGTTGCAAAGCATCAGTCGGTTTGATAACGAATTGTGAGCTCCACAACGTGGTCTCGCTGCGACCGCTTTGTTATCTCGCG
TACCACATCGCGACGGATCTCCTCGTCGGACTTGGGGTTCCAGTACGCGTAGCAGAGTGCTATGGGGATACCAAAGCGCAGCGTGTAGTCGATCATCATC
TTGGGCACCTTCATCGCCTTTGCTGTCTCACTGAATGCGAACTTAAGCCGAACTTAAGATAATGCACCATTTTCCGTTGATCACCATGCGGACGATGGCG
AGGCATCTTCACGGCTCTATCCGACGTGCCCTGACGGCTCCTACTGCTCGATACTTCAGCTCTACAGCTTCTCCACTGCCTGAGGGTCTTTGCTATATAT
CTAGTATCCCACGGACGCCTTCCTGGTCGCTTAAGGAACTTCATCAAGAGGGAACACAGCTCGATACAGTGTTAACAGAAGAAAAGGTGCGCTGCGGTGG
AATACCATAGTGTTGCAGTCATTAACAATACAAATCCATGTGTGTGACAGCTTCGTGAGCTGGCGGAGCTGTGTCATCTGCACGTAGAGGACGAGAAGCT
TCCGGGACTGCTCAAGGATGTGGAGTCCATTATCCAGTGTACCAAGACCATCCAGGTCATGACTCTCAACGAGAACATTGACAACGTATACGCTAATAGT
GACTTCGACGCGGGTACGTGCTAGTCGCATGATGTGGTTTTGGTCTTTCATCTAATCGGTTGTCCGATATGGTGTCGTAGGCGTGGTAGCTCCTCTCAGG
GACGACATCGTTACCGAGGGTCACTGCGCAGAGAAGGTGTTGGCGAACGCTGCAGAGAAGTCTGGCTACTACTTCAAGGTCCCCAAAGTGCTGCAAGACT
AGTTGGTACACGGCATTTACAACGGACACAGTGATAGTTGCCGCTGTGATCGAAGACAGTGACACCATGCTAGGCAAAATCTTTAGTAAATGCGCATTAG
ATCCCCTTTCCATACAACTGCGCAGCGTCCAGCACACACTTAGAAGTCCGCCTTGAAAACGTCGGCTTTGGCCAGGTATTCCTCCAAATCTGTGGGCCCA
ACCACCAATTCAACCCATGTCAGAACAGAACACCCAATGCAACGATGTTATCATCTCAACTATCGTACCTTCAACCTTCATGTCGAGTCCGTTGAGCTTG
CGGATACCCAGGAGCTGGTTCTTGAGCGCACCCTTGTGGTACATAAAGAGAGTGGGACAATTCCGGGGCGGCCAGTTCTCGATGCAGGCCTGGGCCTGGA
TACTCACAAACTTAATGTCGCGGTGCTTCTTAGCTATCTCTCGCAGCACGTGATCCATAACTTTGCATTCCTCGAGCGCTTCGTCCCATAGGTAAGCGAT
GACCCAATGGTCGTTGCTGCCCTCCGTCACCTCCTTTGTCCACTCGTCCTTGGCAATGGGGTGGACGTCTCCAAACTTGTTACGCGCCGCCTGCGCCATC
ATTTCCTGGATTCGACGCTCGCGGATACGAGACAGCTCGGCGTCGTCGTCGTAATCGTCCTCTAACTCGTCCAACTCATCCAGCGTCGCATACTCACGCG
GATCAACCTGCTCTTCCTCCTCCTGCTCTTCTTCATCAGGAACCTTGGTCTTTGGCGCAAGGATTCCCTTCTTGACCAGAATATCCTCCCACTCGGTCGT
CTCGCCCGTGGGCGCGTAGTATACGTTGCCGTGATCGCCCATTGTCAATCGTACGTGGTCTTCTTGAATGGGTCTACCCACTTAAGTCCGAAATGACTTT
ACTTGTTAGATACGATACGTACTTATCCGGGAATGAAAATGGCGGGAAGTTGATCTCGGCGTCATTCGAGCTTTGAGCGCTCTTTTTGGGACCATGGAGA
CCATGAAGGAGATCGCCGTGAATGTCAATGGCAAGGGCGCCATGCAGCTCGTGACGACGCTGCGTCCTATGAAGGACGGACAGGTGCCTGTGGGTCGCGA
CGTGGTCTTCACGAGCGGAGAGGACGGGGTGCTATACGTCACGGACCTCGCCACAGAGAGCTCTGTGTACCAAGCCGAAGTATGCGAGGGTTTCGTGCCT
TCTTTCGCCGTGACACCTGAGCAGAACCACGTACTAATCGCGTCGGATGACGACAGCAACGTGGCGTCCTACAGTCTCCCTCCGGACTGCCAATTTGATC
AGCTTCTACGTCGCTCCACAGTCGCCATCCGTCAGGTTACCTGCTCCACCAACTTCATCGCTATAGCAGACGATGAGCCCGTGGTGCGGCTACTACTACG
CAGTAATACAGAGCAGGTGATCCTCGCAGAGGGGGCTACTGGAGCCGTAAAGAGTGTGGTTCTGGACCCGCAGGAAAATTATCTCTGTGCCAGCAGCGAG
GACGCGACTGTGCGAGTCTTTGCACTTGATGCAGAGAGCCAGCGTGCCACAGAGGCCAAAGCGTTCAAGATCAAGCACGGAGACATCAGGAACGACGACG
TTTTGCTACGTTGTGCCTGGCAACCGGGAGATGCTGGCAAGTTGCTGGCCGTGCCTGTGGACAAGGCGACTATCGAGCTCTTTGAACGAGACTCGTGGGT
TTCCAAGGGCCAGATAAGGCTGCCTGCTGGCAGAAGTACCGCTGCTGATGTGGATATCCTGGCATTCTCGCCAAACGGCCAGTATTTGGCTGCTGTGACG
TGTGCCAAGGAGGTTTATGTATGGGAACTAGAGACACAGACTGTGCTGCGCGCCTTCCGAATCGACTACCCGGCACTTGGCGTACAATTCGCCAACAAGA
GCAACGCGTTGGTGCTCTATCACACTGGCGGCAAGTTGGCGTTCGTCAAGGATGTCATCCCTGCAGGACACACGCCACCGCAACATGTTGCTGGTCAGTC
AGCTGCAACCAAGTCTTCTTATTCGAGTAAGAAGAGTCTAAAAGCTTCCTCATTTATGGACGATGAGGCTGAGGAGGATGGCAGACATGACGAAGACGAC
GACGAAGAAGAAGTGAGTTTTGATGACGATAACGAGGCAAGAGTGGAGGCGATCAAAGCCAGTTTCGGGTTTGGTGCTGCTGCCAATACCAAAGACGATG
AAATCGAAGACGAACAAGTATCTGCGTCTGCCCAAACTGCTCCAAAGCCGAGTCGGCAGGAGAATTCTCCTCTGCGTACACTCACGAAACCTTTTCAGCC
GGGTAGTGTGGTGGACTCCATGGGACGTAGTAGCAGTGCTACATCACTGCTGGCGTGGACACCTGAGGGTGAGATTGAAGTGATTCGAGGCGCCAGTATG
AGCGAAAACCTCGTCAAAGTGGACTTCACAGACAAGTCTCGTCGCGGATTCAAGTTCAACGACAACTACATGTTCTCGATGGCCTTTCTGGACAATTATG
GCGCTGTGTTTGCTGTCCCTCGACGTATTCGTGAGGACTGGGAGGACCTTGACGCTGGCTCCAGTGAAAGTGACGTGATCAGCAGCTTTGTGTTCTACCG
GCCATTCGAGTCTTGGGCGAGCAATAGCTCGTGGCACAAGACGTTGCCAGAGGGCGAAGACGCCGAGTGTGTTGCTGCTGGGCGTGAGTTCTGTGCAGTG
GCCACGTCACTGCAAACGCTTCGAGTCTACACAGCCAGCGGGATTGACTATGCGCTGCTACGTCTTCCTGGTCGTGTTGTGACTATGACAGCGAAAGAAT
CTCTACTAGCTGTGGTGTATCAGGGTCTGCATGGCCAACTACACTACCAACTGCTCCGTATTCAAGTGGATTCGTCCCGTGAACGGGTTCAACTGGTCTC
CAAAGGTGCCCTACCCATGACCCCACCGCCGCGCGATGTGTTCGCGTCACACAAGGAGAACGAAGCTGTTCGTGGAGATATTTCTAACTGGTCTACACTC
ACGTGGCTCGGCTTCGATGACCGTCAGATTCTCTACGCGGTGGACTCGTTCTCGTGTATTCAGGCGCTGTCTCCAAGTATAGGGGGGAACTGGTTCCCTG
TCGGCTGTGTGGGCAACGCGTTGCAGAAGAAACCAGAGGATCGTCACGGTGTCTTTACGCTGGGAGTTGTCAACGATTCGCTGTTGTATTTCCCTCTAGA
CAAAGGCGCTCGCGGCCCAAAACTTCGCGGAAATCATCGTCCTGTGCCTGCTACGTTCGGATTGCGTACAGCATCTTTCCCCAAGACATCGAAGAAGACC
GAAGGGGCCTCTAATGGCCACATGTGGCAGAATGTCCGACTCTGTGGACTGGAGACTATTGCCAACGAGGTTAACGCTGAGCAAGTTGCCGACCAAGTAG
TGCACGAACAGGCTGAGATGGATAAGGCTCTGATCTTGATGATGAAGACTGCGTGCACCAATGACGAGCCTGCGCGTGTCTTGGACTTGGCCAAGTGTCT
GCATCTTGAGAAGTCTCACCAGATCGCACAGAAGCTCGCGATCCACTTCTCTCTGCGGCAACTGCAGTCTCAGCTCTACGAATTGTACCGCGTTAAGTTC
GAGGAGCCTCGACGAATGGTGCAGGAGCCCATGGTGCAAGCTTCTCAGCCGCTACGACAGCCTCGTTCTTATCAGGAAGAGACAGAGCCCGAGCCACGAG
AGGTGGAGCCTTTGCGTCGTGCACGTAGCATCCTGTCTCGGCCTCCGACGACAGAGACGCGTGAAGAAAAGTACGACGAGGAGACTGCGTCGATTAATGA
GGCTAAGGAGGACAAGACCCCAAGCTCACCAAAGACTACTCCCTCGAAGAGCAATGCAGCACGTGTGGAGCGATCAGTGGCGCCGGCGAACCCTTTCCTG
AAGAAGCCTGGCACCTCTGCGGCGTCGCCCTCAGGCAGCAAAAACAAGAAGTCAGGCTTACAGCGGCTGGCCAAGTTCGCGTCGCCGCCTTTAGCTAAGA
AACAGCGTCGGTCGACTTGGAAGAAATAGAGCAGGGCAATGTGAACAGGCAGAGCCACACGACCATCGGAAGTGTCTCAAGTGATTTCAAGTATAGTAAA
GCAGGTGTGTTATCATCTGCATCATTTGTTCTTTTGTCCTGAAAGTTACAGCTGTTGCGTGCGAACTGCAGTAGAAATTGTGTTCTACATGTAGTGGTTG
AAGTGCCATTTTCTGATGACCGTGGAACGTGGAACTTCCACGGTGGAAGTACAAGTAGCTATTGCCTATGATATGCGTAGTGGCCTGTGTATCTTTTGCC
TTCGAAGTCGAACTTGCGAAGTTGCTTTTTGCAATATTAGGCATCGGTTTTGTGCTGGTGTGCCTATAGTACTCGGCGAAATGTACCTATCAAAGGATCT
GTGGGTTCAATTTGTCTAGGTAGAGCGGCGTGAGTAACATCTTTTCGATGTTGTGAATCGGTGCAACTTGATGAAGCCTTTGCAACAGCGGTGAGCAAGC
TATAGCCTGGTATTATCAACCCACCCAGGGTCAAACAAGATCTGAATGTAGAGCGTGCATCTTGCTACCTAATGGCCAGTGATAAGTTATGACTGGCCAG
GGTGGCTCCAACGATGGTTGCCATTCGCAAGGCAGCAAGTACATGAACATTTTGCTCGACAAAAGTGTCGCCATGCTGTTTCGACAGATCAGCTTGTACC
ACGTATCCACGGTGGCTTGTATGCAGTAGCCTACAAAACTTATCAACTTGCAGACTGCATATAGGCCTATTTTAACGTTAGTTGCATCATGCAGAAGCCA
CTGCGCTCATGACGTGTTAGGCCCAGAATTTCTGCTGCAACTAGGTGTTTAACCTGCTCTCTGCTCATAGCAGTGAGCGCCTCGGCTAATGACATCACAC
AACCCAGAATTCTACTGACATCAACGCAGCAAGCCCGTTCATACTTTAATAAAACCGAAAGAAGGTTTCTGGAGGTATTATACTGTAAGACAAATTTGAG
AGCCCCAGATTATCTTACATTGGTAGCATGGTTCATATCGGCGGTAGGTTCGGGCCGAAGCCCCCTTGGCTTTGCCCTTCGAACTTCTGTCGGTGGGTTG
GGAAAACGGTCTTTCAAAGCAGCAGGCGCCAGGGATAGAATCCTGTAGAGTTGCAGCGATAGGCGCGTCGTTGCAGACCTGAACATTGTACCCACCGGAC
ACCACGATGACGGTGCTTGCTGTGCGACGTCCCTCTCTGCTGAGAGCTCTCGGTCATTCTCAAATTGGCCCTGAGTCTTCGATATCGCCTCTGCATGAAT
GCCTCAAGCCACGCCCTCTTCTTCCTCTTCTACAACGCGTGCGCTACCCCGAGCCATTCAACGAGGTCGATCATGGCACAATAATGCCAACGACAGACTG
ACACGCAAATTAATGATGCTGAGGCTGCGGCGACTGCATCCAGTGCTCGCAGGGACCAAGTGCACGACCACAGACAGCAATGGCAGTACCGTTGTGGTGC
CGTCACTAGTGCAGCGACTCGAGTGGATGCTGTACAACGCTGCCCATTCAATGCATGAATACACCCATGAACAGTCCTTAGAACGCCGAGTACAGGCCCT
TGTGACGCAGCTGGAACCTAAAGTGACACGTGAAGGTAACAGCAACAGCAAACGAAATCGAAACAGCAACAACGAGGGCTCTGATCATGGTCCAGACAAG
AAACGCCAGTGTTTTAGCACCAGGTCTCCCACCCACAGGAGTGTATTTCTGCTGGACAACGACGACAACCTCGTTGGACTCGTGCTCAGCTTTCTCTCCG
GTCGGACAGTACTGCGGCTACGCTCTGTGAACAAGTTTCTGTTGGAAAATGGTCCAAAAATGGTAACTGCGCTGCATGTTGAGACACATGCTCCAGCTCT
ACAGCATTTCTCGACTGGCACTCTGACGCGTTTGTTGCTCAGTTGCAGTAAACTCACCAGCCTCGTCGTCACCAGCAAGCTCCGATCTCACACTGAAATG
GTCAGAAAACCCTCTCGGGTGATGGTATATCGCCGACTTTCCTTCAGCCGCCCATTGAAGAATGGCTTACTTGCAGGCGAACTGGTACTCAGGGATATTA
CGCGTGCGTTTGAACGAGGAGCATGTCCTGAGTTGCAGGAACTGGATCTTGGCTCACCGCTTGATTATTTCGCTGAAAGCGACGACGTGCTGAAATGTCT
GGAAGCTTTCGCGACAGGAAGACGTCGTAGTCTTGGAACACAGCGAATTGCCGCTCCTCTTCGGTATCTACGACTCGACTCTACCTACCTGGGCGATACG
CGCTTGAACCGTGTGGCGGGTGTGTTTGAACAGGCTACAGAGGGCAACTGTGTAAACTGTTTTGGGTCGCTGAAGACGCTTGTGCTGCGAAATAATTTCA
TTGGGGAGGCCGGTTGCCAGGCACTACTGCGCGTGTTGCAGTGTTTACCAGCGCTGCGTGTGCTGGATGTGAGTGGAAACATCCTCACTGACCTGGATGC
GCTTGCGCTTGCAGACTGGATTTCCTGCCGCGTGGATGATATCAAATCACCGCAAAATCCCCGTACCCAGAACGGATGCTGCTCGAGCCACAAGATCATA
CCAAAAAGGAAAAGATCCGACACGCCAGCCGTCAAGCTGCGCACGCTGTTGCTGCAGGACAACTTCATCGGTCAGGAGGGGCTGGAGGCGCTGTCTACAG
CTCTCAATGCTCGGCTGATACCGCTGTGA