Description :
From Genome Similarity Track
Location :
Scaffold_75:30681- 32127
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.13Cysteine protease family C01A

Sequence
1446 bases(100 bases per row)
CAAACAACCGAGAGCACACTGCGAATTCCTACAACATTGAATCTTACTGTCTCCTCTGAACTACTGCACACTTCAAGACACCTCATGCAAGCATCACAAC
ACGCAACGGACTGACACGCAGGAATCGAAGCTGCTCTACATATCGAGGTTGGTCATGTCGGACAGCACACCGCACACGCCTGATCCAGAGTCAGAGCTGC
TTCTGCTCAGGCGGATGTAGCCGCTCTCGCCCCAGTCCGCTCCCCACGAGTTGCGGATCTTGAACGCCGTCGAGTCGTAGCCGACGGCCACGACAGCATG
GTCCAGCTGGTACGAGTCGCACGACGTCACGACGCCGCTCGTGTACTGCTTCCAGACCGAGTTGCCGGACGCGACAGCGACGACGACCGGTCGTTGATTG
AGCGCGCTCACCAGGCCGTCTTCGCCCTGCAAGTAGGAATAGCCGCTCAGACCAGTGTTCGTCGTCTGGCAGCCCGTGTTGCAGGAGCTCGAGTACCCGT
TCCCCGACGTGTACGGATAGTCGTCGAGCGAGCAGAGCCCATTCTGCTCAATGTAGTCGTACGCGTACTCCGGTGCGCCGCCGTTGCAGCCCCAGTTCTG
CGAGTCGCACGACACGAGCTGCTCCTCCGAGTACTTGTTGAGCGATTTTTGTCCGTTGGCGATGCACTCGGCCGACTCGACTGCCGACACGGTCGCGAAC
GCCCAGCAAGAGCCGCAGTAGCCCTGGTTCTGAACGGGCGAGACGCACGAAGACGTCGTCCAGTCGACTGAATCACTTTCGCCTTCAACTGCGGGGCTTT
CCGTCTCCGCAGTATCGCTCGGTGCTTCAGTGGTCGGCGTCGTGTCGCTGGCCGGCGACTCCGTGGTAGGCGCGTCCGTTGTCCACCAGTCAGGCCACCA
GTCCGAGTCGTCGTGGTTTGAGAAGGTATTCGAGCCGGACAAGCTCGAGTCTGTGACTGAGCCGCTGCTGATATCCGCTTCACCTGCAGTCTCATCGTCG
AACGCTGGAGCGACGGTGCCAGCCTTGAACTCGGTGAGCGCCGAGTCGATCAGCGCCTTGATGGTATCGTACAGCGAAGATCCAGCAAAATCATCACTCG
CTTGGCGAAGTTGCCGCGATCTGGTGTTTGGGCGAGTGGCATTGCCCTTGACGTACGAGTTGGCGACGTAAGTGTTGAACTCATCGTCGGTCATGAGCGT
GAAAGGCGAGTCGGTCGAGAAGTTGGCATTGGGATTCTGCTCCTGCACCGTGGCGATGTTTTGCTTGGTGAGGAAGAAGCGCTGCATGCGGTCCTCTTGC
ACCGCATCTTCGCTGCGCTCCTCGGTCGCCGGGATCCATCCATTCGCAGCCGCACTTTCGCCGAACTTGGTCATCCACTCTTCGAGTTCGACGGCCACGT
CGTCTTTCTCTGCGAGATAGCGTTGGTAGTCAATGCCCGCATGCAT