Description :
From Genome Similarity Track
Location :
Scaffold_68:30680- 35310
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_68-snap-gene-0.24Lipase domain protein
Pytul_var.sporangiiferummaker-pug3_contig_68-fgenesh-gene-0.7Conserved gene of unknown function

Sequence
4630 bases(100 bases per row)
CCCAGGACGACCCAGAGACCAAAGTATACCGCCCGCTGCTGTTCCACTNNNNNNNNNNNNNNNNNNNNNNNNACGCGTCGTCGGAGCTCTTCCGCGACAC
GTACGAGATGCGCACGCGCATGCAGGAAAAGCGCCTGGCAGCCAAGGCTACGTCGCCGTCGTCTGCGCTGCTGGCGGTCGAGGACTCCGACTCGGACGAC
GATGACGATGAGACTGGCGAAAGGACACGTGCGAGAACAACGAAGAAGCCACGTCAGCTGCATGATGATGGCGGTGTGATTCANNNNNNNNNNNNNNNNN
NNNNNNNNNNNGGAGACGCTGTCGTCGAGAGCCGCGACGACGGTGCTGTGGATCACGTATCTGGTGTTTTGTGTAGCGATCGCGATGCCGTATCTGCAGA
GTCAGGGCTTTCTCGGCACTGTCGTCACGTTACCAGGCGGACTTTGTACCACCACGGAGCACTTGCTGCTGCATACAAAAGAGCCGTGTATTGTCGTGGA
CAAGAAGAAAGGCGTCGCACAATGGTCGGGTATTGTGAACAATGTGTCGTGGTACGCTGGGTCCATTGAATTAGCATTGGATATCAGCGAAGTGATCAAT
TCGACGGCGCCGGCATCGATGCAAGAAGGCGACGAAGGCGATGAATTGCAGCAAATGGACGCGCTCTGGCGCAAGTGGCGTCCTCGTCCGAGTGTCTTGG
ACGATCAAGTGTCTCTGGAGATCATGGACCAAAGCTTTGCGCTGCAGTACGACGTGTTCCTCTATGGCATCGATGTCGAGACGATACCAATCGCGAAAAC
GCTGGTTGTCGCTGAGCGAAACCAAAGTGTGTGGGTCCACTGCCCATCGAAAGCGTGCGGCAAAGTGCGGCTCCTCGATGTCTCGCAGGATTTTGAAAAA
CGGGTGCGTTTTGGTATTCTTTCTGGTGGCTAATGGTTAATGGACGTTGCTAATCCATTGCTCCCGTGCTGTGATTACTCCTTGTATTTCTGGGCTGCTT
GTAGGAGGAAGGTGGGTACGGCTCGTACTTGGTCGTCGTGGTCTTCAAAGGCGTGTACCCAAATGCATTCGGCAAGAAAGTGTTGTATGATTTCTCATAC
ACGTACGTAACAAACGCGACTGTGATGTTTCGTCTGTGTTGGCATCTTGTAGTGGAGGATGCTTACAATGTGACTATGTATGTCTTTTGTAAACAGGAAA
CCCGCACTTCATGTGAGCGAGCTGATCGTTCGCACACTGTTCCTCGTCGTGTCACTGTTTGCGCTTCCGTGCTGGTTGATTGCAGTGCTGAACTACCATG
GGAGCTGGCACGAGATCCTGTCCGTGCAAAAGTGGGTCTTTGCGCTCGGCTTCGTGCTCATGCTGTGGCAGAATCCGATCTACGCATTGTCCGAGTTGGC
GAAGACTGTGAGTCTGCGCACGCGGTTTGTCGCCGAGATGTGCGAATCATTTGCCGAGGCATTCTTCTACGTGTTTTGGCTCAACCTGCTCGATCGCCAT
GGTCGTGCGGTGCGCAAAAGCACGTTGATTCCGAAAATTCTGTTTGGCATGGCGCTATTGGCTGTGGACATCGGCATGGCCGTGATCCGCATGCCATCGC
TATTTTCTTCTGCTTCCACCCGTCATCTTAATGCGACGACACATTCATCCACGATGGCGAAACATGAAGATGAGCTTTATGCCGCTCTCGGCTTTGTGCG
CATCGCGATGCTCGTCGTGTGGCTCGTGTGGATTACGCGCATCGGCTGGCAAACGGGTGTATACCTTCGCCAGTTGCCGTACATGTCGACACGTTTCCAG
CAGCTCTCATACCGCTTCTTGTCGCTCGAGACGATTTTGATCCTGATCTACGTCATGGTGCTCTCGGGGGTGCAAGTGTTCTTCCTCTTGCAGACATGGT
ATTTGATGGGCTACGAGCCGTTTATCCAGAGCGCAGTGCACACGTTTGCGAAATCCCATTCTGGCCGCCCGTCGCTCGGGAAACTGATCTTCCTCTCGGT
CTATGTGTATCTGGTGATGTTCGTGCATCTCCCGCCTGAGTCGGGGGACAGCATGGGGCTGTTGGCGACGACCGCGTATCATGTGGAAGAGAAGCCGCGT
GTCGATCAATATGGCTTCTTGACCCCGGACTCGCACTTGTTTTGCGTCGAGACTGCGACGTGGTTGCTGGAAATTGCATGGCAGGCATACTTTGACCCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGGGTATGGAGAGCTCGATCTGGAGCCGTACGGATTTGACCTCGTGACGCACCTGCGAAGCAGCT
TGACCGATACCCACGTCGTAGTGGCGCTGAACCAGGACCGGACGCGATTGGTCGTCGCGTTTCGAGGCACGACGTCGCGAGAGAACTGGAAGAGCAATCT
CCGCTTTCACCAAAAAGTGCTGTGGATGAAATCGCGCGGACGCTGGCGGCAACGCACATGCATGGAGGCGACCAAGGATTTCCTGTCGAAGATCCCGCTG
CTGAATATGGCGCTTCCGCGAGTCCATAGTGGTGAGCTATCTAAATGGTTTTTGTGAGTTTGTTTCATTGAATCGGCGCGGACTAATAGTGTACGTGATG
GGATCAATTTGGTTGCACTTGGCTGATTTGCACTTGTAGGATTCTGGAAAGCGTATGCGTCAGTCCGAGACGAACTTAAAGAAGTCACGCGTCTGATCTT
GGACGAGAATCCGGGAGTTACGGTGTACGTCACTGGCCACAGTATGGGTGGCGCATTGGCGATCCTCGCCGCGTACGACCTCGCCGTGAACTTCAGCATG
AAGGTCAACATGTACAACTTTGGTGGACCACGGGTCGGCAATCCGAGCTTCTGTCGCCATTATAATAAGTGCGTGCCAACGAGCTATCGTGTCGTCATGG
ATGGAGACATTGTTCCAGGAGTGCCCAAGTTTGTACGTCGCCTCTTTATCTATCTCATTGTTAACTTGTCAAGTTCTGTTGATTGCTGTGCGAATGATAC
GCTGACTGTTTATTCTGTTGTCTGTAGTGGGGGCTCTACCAGCACGTTGGAACGGAAATCGCAATCGACCTGGAAGGAAACTTGATCGTAGATCCGAGTT
TCGTCGAGCGGCATCTCCATGTATCGTCGAAAACCAAAGTGGCGACTCACCCATCGAGCGTATACCGAGCCTCACTGACCAAGTGCTTGGAGAACCTGAT
GACCAATTAAGTATTTCGTTTTTCTCGAGCGGCATTGTTTTGCCTTCAAAAACAGTTCTACATCCAAAGTTAGCCGCAGAGAAAGCGTTCTAAAACTAAA
ATACGGGTATGATCCGTTTCGAAACAATCGCTTGAGGGTAAGTTCGCGCGCATTGAGTGAGTGCCAGAGCTCACCACAGAAACAATAGACTTGGCGAGAC
GGTAAGAGGGAACGATGGCTGACTTTGAAGACCAGCAAGACCGTGAAGGCGTCATCCGATCGCATGTCGAGTTTGCAGAGGCTGCAGCAAATGGTTCGCG
TGCAATGGTACGTGCTTGAACGTTTTTCAACGTCAAGTATGCATTTTGATGTGCCCAAACTAATAATTTTACGGGCACAGGTCGAGTTTCTTCTTGAAAA
TGGAGCGCACATTGACGCCCCAGGAAGAGGTTTGTCTTCCAACATAGTCCAATTATACTCGAGTCTACGCTTGACACCCACTCTGCTTTCGGTCACGGGG
CTTTGCTTAGATGGCACGACACCGATCTGCGCTGCCGCACTTTGGGGGAACGATTCCATGGTCAGCTTCTTGCTCGACAAAGGAGCTGATATCCAAGCGA
AGAATGAAGGTGCTTGTTGTTTTTCGAAGTTTGACGGACTTGTTTCCAGCCAAGACTGATCAAATTCTTGTCGGCTGCGCAAACTAGGCACTGGATGGAC
AGCTTTGCATGCTGCAGCTTTTCAAGAGCATGGAAAGGCTGTGCGCGTTCTCCTGGACCGCGGCGCCAATCCCAAATCGGCAGATTCAGAGGGGAGAACA
CCAATTGACTATGCGAGTATCTCCGAGGCGATTTGGCCGTTTTTTGCAGGTAATTTGCTGAGTCTGTCCTGCAGTATTGGCCAGAGAAGGCGTGACGACA
GGGAAATTATTCATGCACGCCTTGGTTGACTTTTTGAAAGCCCGCGGCTGTAGGAGAAGTCAAAAGTCGGAGTTGATCGCAAAAGGAATCATTCGGAAGA
TTGCCCAAGATCAACCCGAGCACACACCGAGTGGAGACAAGTACTCCGACAGCGTACGATCTCTCTGTTGTCGCATTTCCTCAGTGGCTTTTTGGCAGCT
TGCTGTTCTCACATCATGGCCTGTGTGGATTGATGCAGCATGCACCCCAGCTTTCTTCATTTTCGCGACCTGGATCATCGTACACAAGAGCTCAGTTCCA
ACCACCAGTAGGCAAGCGGCAAGGAACTGCTAAAGTATGAGCTACATAGGTTTTCGAGTACGCAGTTTGCTCGCTTTGTATACTCACGAAATTTTTCAAA
TTTTGTTGCTGCATAGTCACGAGATGGAAGAGCCGTTGAACCAATCGATCCGCTCGGAGACGCGCCAGTGCAACGACCATCAAACCAGCGCCGCCCATCT
TTTCAGGGTCTTGCCCTGTAGAGCTGGCAC