Description :
From Genome Similarity Track
Location :
Scaffold_36:30676- 35329
Transcript NameFunction/comments
Phymu_g2119hypothetical protein
Phymu_g2120Major Facilitator Superfamily (MFS)
Phymu_g2121hypothetical protein PHYSODRAFT_506618

Sequence
4653 bases(100 bases per row)
CCTGGAGCCTCAGCACTTGGATTTACCGTAGTTGTAGCTGCATCTGTATTGGGGGATTCTATAGCTTGGGGACctgacgttgctggcgctTCGGTTGGTG
TCGATGTCGTAGTTGAGGCGTCAGTATTTGCCGACGTACTCGACCCTACGGTATTTGGAGAAATGTCCGAcgtggttgaagctgtcgctgGTGGGGCACT
GGTGATCGAACTTCCGGCAATCACGGTGGATCCATTGGTGACAGCGCCGTTGCAGTCGTCCAGGACGATCACCGTGTTGCCCTgtgcatcttcttcgaag
tGGAATGTGGAGCACGTCGTCTGGGCCGAATGACTTGATGCTGCGAAAAGAGTGGCGAGTATCAGTGACGCGATGATCTTCATGATGCTGGTGGTAAGGC
TGTTGTAGTACTGTACGCTAGTCGAAGTGAATTCGGAAGTGGTTGAGAGGAGATGTCTGCAATTTCGCACCGAGAAGATGTCACCTCTGGAGCACGTATG
GGCTTTTCCTTGAGGCCAGTCCGCCTACAAAACGCCTTTTGGGCAAATGTGTGGATCAGCGGTGGAtcatgaagcagcaactcgtGCTTCGTTTCCATGA
TCGCTAGGCTGTCAATCGATCACTTTGCTGGTAAAAGCTCAAAGTTGAGTTACTCAACATTACTGAATGCCGTGGAAAGTCACTACTACTGGATACCTCG
CCGAAAACTCGGTTTCGAGTTCTGTGGAGGATAACCTGGTGTCAAGATGAGATGCTGAGGTTTTGTCTGGTTATTACACTCGTGGTGATGGAGCTACGTC
GGATAAGTGTATGAAACTCCTAAAGGACAGTACGAAGTTCGTACTACGAACATGTTCAGAGAATTCATGAGGCAACAACCGCCAGCCGGTAATTCGGCAG
GGTGGCAAGATCGCTGGGGACATTTGAAATGCTGCACGGCTTGACTCTGAGGCTTACAGTACATTTACCAGCCTTACCACTGACTTAACTTCTACTAAAT
TTCGTGCACACGGAGTTTGGTCGGAAAAAAAAGAAAGGCATCCATCCCATTCGGAGAATCCTATCTCTCCTGATAATTCCCAGGACATGTTTGCCGTGTA
CGACGTGCCAGAATGATTATGACTTCCTCACGATGAGGCTCCATCCTAACAATCTTCTCATACACCAACGAAGACGCTCATGTTTGAGCATCAGCAAGTG
AAGTGCGGATATAGTAGTTatccacctgcagcttcaactttaCGGACAAGGGACTTCGACTTGGAGACTCCCAACTTGGGAGTCCCAAGTCGGATTTCTA
GTTTTAAGTTCTGCTGGCAACGTTGAAGTTCTTGCCTCCATGTCCTTTTTCACATGAGAAAAAAGAGCTTCGGTTGTATTGGTCACATCCACGAAGCTCC
AGCATTCTCGAACGATTGCCTGCAACGCGTAAGGAGCCACCAGACTGTGGTTGAAGTTAACAGTACTTGAAGACTGACAGTCTTTGTTGCCTTCTGCTCG
GATCCAATTGAATTGACAGGCGCCTCGGAATGTACAGATCTACTGTAGAAGGGGTGTCCGTCCACGTATTAAGTCAAAAGCTGGCGTCCGTCATTGCCCT
TGACTAAGTTCCTGTACCGAAGTCGGCAATTAACCCTTTCGTTCTATCCGAATAGCCGAGTTCTCCAGTGAAAACCTTGCGTCTCAGCTTACCTAAAGTG
GCTGACGCCATGACATTCCTGAGCGCGATGCATCCCACGACCAGCAAAGGCCCGCGAGGAACTTCAACCACCGCCATCTTTTCGTTGACGATTTGTAGAT
GTGTTAAACCGCgttggtacagtacatgaCCTGACATTCAGCCGCATAGCCAACAAGCTTCTGCACCACCGCAACGACGTCTTCCGGTCATAACtagtgt
acatgtaaatgtGCGTTTACACTGCAACATGTacgtcttgagctccagtggatcGTCTGAGCCAGGACGCGGGGCGCTTCTGAAGTAGCTATCTCACTAT
CTTCAGACTTCAGACGTCTCCGACTGTCAAGGCGCTTGAAGCATCCCGACGGTCCATACGCGGCAGATTTGGTTGAAGCGGTACGAGATGAGCCGACCGA
CCTTCGATTTGTCAAATCGGAACGCTGATGTTCAACTGCGCTCACGTGCATCGTCATCGATATGATGGATCCATTCTGGAACATCGAGCTCGAGACGGTC
TCACGTTGAAACCCCGAAAAAGAAGTCATTCTGACTTTTGCGTCTTAATACCGAAGCATCCGCCGTAAAACAACTCCTATCCCTTCACGTTTGCCATGAC
CGTGGCGATACCAATTAATCGACACACAATGGACACGGAACCCACCGAGGGTAGTCGCACGTACGCTATCGTTGTCTGCGCGTTCGCATCGCTTggtggc
ttcttcttcggctaCGACCAAGGCGTGACATCCGGTGTCCTGATCATGGACTCGTTCCTGAACGACTACTGCGTCGGATGGCATAACTTCACCTATGAGG
AATGCACACGCTCCACCTCCGACCTCCCCGGGGAGTGGACGACCTTCACTGTCTGGTACAACATGGTCTACAACCTCGGCTGTCTTGTGGGCGCTCTCAT
CGGCGGCTACGTCGCTGATAGGTTCGGCCGTCGAGCTACAATCTTCTCCGCTGGTGTTCTCTTCTGCATTGGAACGACGTGGGTGTGCTTGAACCCCGCA
CAGGACCACACGCTCATGTACATCGCACGAATCGTGCAGGGCTTCGGCGTAGGCAATTCGTCGTTCTCCCTCCCGTTATTCGGCTCGGAAATGGCCCCGA
AAGAGCTTCGCGCACGTCTGTCGGGCTTGATGGTGTTCCCTGTCACGTTCGGCCAATGGCTCGCTAACCTCGTCAACATCCTGGTGGAGAACGATGACAA
TGGATGGCGGATCAGTAACGCTGTGTCCATGATCCCTCCTGTTATCGTACTTTGTGGCATCTTCTGCGTACCTGAGAGCCCTCGCTGGACGTACCAGCAG
AAgggcaaggagaaggcggaggctgTTCTCAAGCGTCTTCGTCAAACCGACAACGTTCGCCATGAACTTGAAGCAATCGGCGACCAAATCGCCCAGGAGG
AGTCCGAGGGCCTCGGACTCAAGGAGCTCTGGGAGCCTTCGGTCCGCAAGCGCGTCTTTATCGCCATGgtcttccagctcggacAGCAGGCGACCGGTAT
CAACCCCATCATGACCTACGGCTCACTTATCTTCAAGGATATCACCGGTGCCGGTATCTACGCGTCGCTTCTATTGAGTGGTGTGAACTGCTTGAGCACG
ATGCCCGGCTTGTTCATGCTAGACAAGTTTGGTCGTCGTCAGATGGCGTTGATCGGAGCCTGTGGGATGTGCATTGGCCATCTCTTCGCTGCGATCCTGT
TCACGGTCAtctgcgacggcaacgtcgaTGATTCTGGCTGTCCTGAGGTTGGAGGCTGGTTCATTTGTATTGGCACagcgttcttcgtcttcagctacgC
CGTGTCGTGGGGCGCTGTGCCTTGGATCTACTGCTCGGAGATCTTCCCAATGAACGTACGAGCGACTGCCGTGTCCCTCTCCACGGCTGCCAACTGGGTC
GGAGGCGCGCTAATGACGGAGATCGTCAAACTGTTCCCATACCTGAAcatcaacggcgtcttcttcctgttcgctGGACTCAGTGTGGGCTGCGGCGTGT
TCGTGTACTACTTCTGCCCGGAGACCAAGGGCCTTTTGCTTGAGGAcatcgaagagctcttccatTCACGTACCAGTGCCAAGTCGCCTGCGTACGTTGA
AGCCAAATCCCCAGTCATCGTGGCCTAGGAGTGCCACAAAGACTCGTGTACTGCTAGTAGGTATGGTCAGTTCCTCTCTAAAATGTTAACCAACGTAAAC
TGTTCCCTAAACTTGACAATTGCTTACGTAAGGATCgttgcaacttcaacttggcatGTAATTTGTCCGAATGTATTGTCTTTGTTAGTTCTTTAGGGAC
CAAATCATAAATTAAAATTAATTTAATTGTGTGGTGTGATTGGCACTTAAATAGTGTTCCATACACAATGTCcgaattaaaaaaaaatgaaattTAAATA
TCATTAAATATCGTGCTGAGGCCATGGCGGAGGAGGATCAGCGCCGCACAGAGGACTATTTCCTCAATACGTCCAAGCCCAAATGGGAGGACGAGCGGCG
TGAGCAGGTAGAAGCGTTCTTGGACCATCACCGCGTCGTGGGTAAATGCGTAGCGGTCGTGACGTCGGGTGGTACAACCGTCCCGCTCGAGCGCAATACC
GTGCGCTTCCTTGACAATTTCTCCACTGGATCCAGAGGCGCTGCATCAGTCGAGTACCTGCTGGGGCTGGGTTACGCTGTCATCTACGTGCACCGTCCGG
GGTCAATTGCCCCCTTTGCCAGACACTTGCAGCGAGCCACGTGTTCATCGTTGGACGTGGACTTCCTGCAGCATGTGGACGTACCCACGCGCAACGTCCA
TGAGCACCAGATCCGCGTGCTGGTAGAAGATCctacagccaagaagaacgttATCGATGCAGTGAACAAGCTCCGCAATGTACGTGCAACCAACACGCTG
CTCTCACTGCCGTTCACCTCCGTAGACGACTACTTTTTTGCCCTTCGGATGGT