Description :
From Genome Similarity Track
Location :
contig_42:30672- 31770
Transcript NameFunction/comments
g9018.t1OWZ18522.1 hypothetical protein PHMEG_0007369 [Phytophthora megakarya

Sequence
1098 bases(100 bases per row)
GTCAGCAAGTTCCCCCTTCCGGACGGGTACTTCCCGCCGGTGAACCTCACGCCGGCCGAGATCGAATGCTACGAGCAGCGCGTCGAGATCATCATGAAGA
ACGCGCTGGCCGAATACAATTTGCACGAGGCCATGGGCGCCCGACCGGACTACGGCTCCCGATGGACCGTCGTGGGAAACGTCGAGCATCTCACTGCCAT
CCGCGAGGTGGATCCTTCCAGGGCAGTCGAGGCTTCGCGCGTGTTCGGACGCATCGACGGCGACTACCGCAGCTTCCTCGACTTCTACTACTCGGTGACG
GACCAGCAGGTCTTCGCTGTGAACCAGTTCATGTTCGGATACGCCGTGGACGCGGCGGTGCTGGGCAACATCCACACGAAGGAATCCAACAAGCCCCACA
TGTACTTGGGCATGAAGTGGCTCTGTTTGGACCCGTCGACGCTTTCACGCAAGCGCGATATGTGCTACCTTGAGTACCTTGTCTTCACCAAGGACCTCCA
GGGCCGAGACGTCGGCGTCCGCATCACGCTGCCGCTGCTCCTGGACGAGTGTCCGCCCATGCCGGAAAAGATGAAGACCCGGCGGATTCACTCGCACGCA
GTGACTATCGTTCGACCGGAGAGCGACAACGCCGACGCCACTCAAATCTTCATGACGAGCGAGGTGGACATGTACAAGGGGTCCACGTCCTCGTCGGTCG
CCACGTTCAAAAAGCTCATGACGACGCTCAGCTCCATGGCGCTGTTCGCCGACTCGAAGCGCATTTCCATGCAAGGCATGCTGGACCGCCGCAATTGGGC
GCCCAAGAAGGCGTGCGCGAACTGCACTGTGTGCAACCGCAAGTTCTCAACCACGCGACGCCGGCAGCACTGCCGTCTCTGTGGCGAGGTGGCCTGTCGT
CGGTGCATGATAATTCGTGATGCACCATTGCTGAATGATAACGCTACTGTGGCGCCACGGACATTCCAAGTTGTCAAGACGATGTTCTGCAAGGCTTGCA
TGGGCAAGGTTCGAGGCAGCGAAGTCAAGTCTATCACCAGCGGCGACAGCCAGGACGAAGGCGTATCGGACGCCGAGTCCATGAGCTGGTTCCCGGAC