Description :
From Genome Similarity Track
Location :
Scaffold_25:30670- 35793
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_25-fgenesh-gene-0.11Cleavage induced predicted protein
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.44Rabenosyn-5 (FYVE finger-containing Rab5 effector protein rabenosyn-5)
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.33Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.34Conserved gene of unknown function

Sequence
5123 bases(100 bases per row)
AGACGGTCATGGCGGCTCCTGGTATGTGTTCTGGCTTGCTGTCTTGATTTACACAGTGTGCCAAAAAGTCTAACAAACTTGGGTATGTATGTGTACCGCG
CGCCTGAGAAGCGACGATCAACGTACGTGTGCATTTGATGTCCGCACTTACGCACTAGCCCATTGAGAGCGTTCTGCGTTGCCTCATGCTTTGTGTTGTG
TATCACTCTTAGAAACGAATCGAGGACCTCTCTGCTCCAGCAAAGAAACAGACTGAACGCAAGTTTGCCACCGACGACGAAGAGCGCCATTGCCGCTTTC
GGACGCGCAAATTCTCAGCGAAGAAGGCTGCAGCCTCGGATTACGACGACGATGGCGCGTCGTCCGGGAAAAACGACTTTATTGCGCGCATGGAGGCTGC
CGAGAAGAGCAAGCAGAAGGTTTGTTGGTACAATTTGTTATGGACAGATAGGTGGTGCCGACGCTGTCCTCACAAAGTCGTCTTTCACTGCCATGCTTCA
CCCAGAGACTAGAGATGACTCGAGGCGAAAACGAGTACAACGCGCGGCTGGTAAGGAGATAAACCGCTTTTTGATGACAAATATCCGAAAGGTAACTAAC
TCATCGTCTGTCCAATGTTGTTATGCGTAGGACAAGAAATGCTGTCCAAAGTGCACGATGCCGCAGTCGTACTCGGAGTTCAAGGAGAAGAAGAAGCGCT
GCCAGATGTGTGGCGTCGAGTTCCGCATTCTGCAGGCGTGGGGGGACGTTGGCTCGGAGTTCATCTCGCGGATGCACGAGGCGTCGCAGGTGAAAGCCGA
GAAGCAGCAGCAGATCCGCGCGCAAGTGATCCAGCATGAGACGAGCGCCATGGAAGTCAAGAAGACTGCCAAGCAGCAGTTCTACGAAAAGAAAATGGTC
CAGAAGAACAGCCAGCGCACGTTTCTCGAGCGCAACTACCAGAGCAACTCGACGTCCATGACGAAGCAAACACAGATCGAGATCGAAATCCAGGCGCAGG
CGCAGCGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCATCGCATCCAATGGCGGCGACTCGCCTGTGATCTGAGTAGCATAAGATAAAAGCAATA
AAAGCCTGACTTCACTTCTATTTCCTGCTAGGTAGTCTGTTTGCGCTTGTCAACACGACGGATTTCTATTATCTGGTGATACTCGATGCAGTGGCGTGCT
GGTCTCCATGAGCGTCGTCATTTGTCTGTGGAATCAAAGAGAGCATAAAGGTCAGCTTCAGTCCTAGCTTCGCAGCAGCAGGATACAAACACACAGGACA
CAGGCTAGCAAAACGTACTGAGCGCGATCTCGCGTGGCGCTTCCCAATCGCACAGCGATGTTTTTGCTGCGCGGGAGGGAAAGTTGCTTCGGTTTGCAAG
AGTTTTTGTCATTTGGAGGCCGTGACTTGAACTTTTCCATGTAGGAACTGGAAGAAGCAACGAGAGTGGATGATGATACTGGGCATTCATTTGGCGTAGC
TGCAGCCGGAAGGATCACAGCCTTGCAAGAGTAGAACTCTGCTGGCAACACGGGCACAGGCGGGCGCTTCCACGGTGGGAGCCTCCGTCTCCCGCCACTC
GTAGCACTTGATGCAGCGAGTATTGTCCGTTCATGGTCATCGATGGAAATCTCAAGCGTAGGCGCGAACTTTTCTGGCCGTTCCATTTGCTCGGCGTCCT
CTTCTGCTAGCGGTGCATCATCAGGTTGAATGATTGTTAATATATGCTCGTTTGCGATCGCGTCCTTCAAAGACAATGTACTGCGTTCTTTCTCTTCATC
TGTGAGATCTTCTAATGGCTGTGCGTCAACAACAGCGTCCTGATTGTCCGGCGACATCTGGAGACAGTAGGCACACACCATAACGAACATCATCACCCAC
GTTGTCCTCACAGAACGTCTATGCTCGAAGTACAAACGACTCACAGGATCCGGCGTTTGCTGCTTTGGAACGGAATTCAGCTTCCGCTGGCACCCAAAAC
CTTTGGCGACTTGGTCCAGCTCTCGCTGTCTGTTCTTGAATTGCTGCAGGCCTTGTTCAATAAGCTCAAGCTCTTTCCTGAAAACGATAACAAAACGCAT
CAGTCAATTCGGCAGAAGTAGCAAACACCAGGCGGTCGAAAATGGATGCACTCACCGCTTCTGGGCTTCTTCGATTGCCTTCAGCCTCCGCATTCGCTCA
GCAGTTTCCTGACGAAGCTTCTTCTCCTTCCGCCTCCTCTCTGTCTCATGGTCTTCGTCTCGCTCGAAAGCTACTTCAGGTGCCTCACTTGGTCCTCGCT
GTTGCCCAATTAGCGCTGGGTTGTTCGGCGTATGCGGCAATCTAACTCAACATTCCTAAGGTTAGTAAGACTATTAGAGACAGTGGAAGCAAGCAAGTAA
TTCATAAGAAAAAAGCTGTACGCTTGCAGCCGCGCCAGGGTCTTCCTTCGAAACCTCTCGAGTTTCGCAGGATCATGCGCTGGTTTCTCGGGGAGTAAGG
TCTGAGCCTTTTCTGCTGTCACGTGATTTACCACTTGTCTATTCACGCGGATCCGCTCTTCTGCTCGCAGCCTGCTCTGCTCGAGGAGTCTCTCTTTATC
AGCGAGTTTCTCCGCTTGTTGCAAGGAGAGCTGTCTCTTGATCTCAAGCTCTCGCTCGGCTTCCATTTGGTCAAACTGGCTGGTGCGGGAGACCCGTGCA
CGCGCGCGTTCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTTGCGTTGCTCTTCCGAAAGCGTCTTGATCTCCGGAAG
CGCGACCAAGGTCTCCTGATTATTGCTCAAGCCCAAGCCTGAGCTCTGTTTCTTCAGCGAGCGCTTTCGCTTGACGGGGGCAACTAAGCTCGCACTCTCA
GTCTGCGGCTTGCCCTCAGTGTGACTCTTCTCACCTGACGTGCATACACGACCAGTTAGGCTCCATTTCCACTGAGGGTGAGGATGCAGATCGCAACCTC
CTGTTCCCACATACCTTGTTGCTTTTGCGGTCGTTGTTGTACTCTGTTGCCCGTTTTCGAGTCGCGTGTGTGCTCGTCCGTCTGGTTCCCCTGCGGCACA
GCGCGCGTAAACACCGGGAGCGCGTCCGAAATTGCCAGTGCGGCCAGACACAAGCGCTTCGCGCGCTCCAGCAGGTCGTCATCGGCGTCACACTCCTCCA
TCGTCAACTCTCCTGGCCACCTTCACAGTCGCGCACAAGACCATCGCATTCTGGCCAAGAGCGCCAATACAGTCAGTCCCTGTATAAATAGCTCGTCTCG
CTAAAAGTGTACCCAAGTGCCAAGGGTGTTACGTTATGTTCGTGTACCCACCTCATCGCTCTCTTTTAACAGATTTGTCTTTCCAAGGAAAAAACGGGCT
TGTATTTCATTTTCCAAAGAAGGAGGCTGCAACGTGGCCGATTGACAGCAAAGGGGTACCTCTTCTACTAAGTACGTTTTATTTTGCCTAAGTGCGAGTG
CGAACTTTTTGAGTTCCCTCTCATCCTCCTCCCCCCGTATCTCCCACACTCACTCTCTCGCGCGAAACCTCCCGGAGAACGCGGACGTCATCACGAAGGC
GCAGGAAGGACACACTCTCTCTCTCTAGAAGAAGACCAGGAGCAGCAGACTAAGCGCACGATGGCGGCCAAGACCACGTCGCCCAAGCAGAAGAAGAAGG
CGACGTCGCCCGCGAAGAACGGCAAATATGCTACTGACGACGACGCGATGCAGCAACAGACCGAGCTGCTGCGGCTCGAGCGCAAGAAGCTCACGCTGCT
GCGCCGCCCGTTCAGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCATCGTGCTCGCGCGCTTCCTTCAGTGGCTGCTTGCGTACGTGG
TGCACCACAACGCGACGCGGTTCGTGGTNNNNNNNNNNNNNNNNNNNACGGCGTCGCTCACGGAGGGCGAGCACCACACTATCCTGGACGAGTTCAACAA
GAACGTCGAGTTCGTCGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCGCCGAGGAGTGCCGATCGGTGAACTTTGACTCGCGCAACCACATGTGGTTCCGTGAGTTTGAGGCGAGCTNNNNNNNNNNGGCACGGGCA
TGCATTCGGGTATCCTGTTCCTGTTCCCGCACATCTTCCTCGTCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGCAGTACAACCTCATGAACAGCATGAAGGACTGGATGATCCGCTTCTTGGAGAAGCACGGCT
TCTGGGGCGTGCTGCTCATGTCGGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGTCGCGTTTGACCTCTGCGGCATCTGCTGTGGCCACTTCCTCATGCCGTTCTGGACGTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACAAGCACATGAAGCAAGTGGAAGCGTTTATCGCGAATGTGACGCCGGCCGCGTGGCGTCTCGA
CACCAAGGTGAGCGAATTTTTGCTCGAGTGCCGCGAAAAGTTCCACTCTGCGCAAGGCCAGGCCGNNNNNNNNNNNNNNNNNNNCGAACACGCCGCAGGT
ACGGCCGCCAAGTCGAGTCTGATCTCGCAGGCCGGCTCGCTCGTGATGGTCGCTTTTATCGCGTACTTTGCCGTGTCGTGCATCGAGCAGTTTGCGCAGC
AGCACGCAGCCGAGGAGGACGAG