Description :
From Genome Similarity Track
Location :
Scaffold_147:30667- 32761
Sequence
2094 bases(100 bases per row)
GCTCGCGCGCACCCAGGGCGCTCCGGGACAGCGGCATTAGGCGCTGGCTCGAGTGGGGAGTCGCGCGCACCTGTCGATGCGTGCGTAGCGGCAACAGGGC
CATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGGGTGCGCTTCTCCCAATCGATGCCCGGATCATGCCGTGCAAGCCATGGCATGCCCAATAC
AATGTCAAACTTATCGTCCAGATCCAGGACGGTAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTC
ACGACGGCACCCGTTGCCAGTCGTACCTTCAACATACTTCGAGATATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCT
CCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCA
GTGAGAATGAACCTCACTGGGGGCTGCAGTCCTTAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGC
GTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGAGCCGTGCACTCCCGAGCAAAGTGACCGAC
TCTACCGCAACGGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGGCCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTC
ACTACCGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAG
TACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCAC
GATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTT
CGCGGTGGCTCAAACGCTTGCCTGAGCTCCTCCTTGAAACCCTCGTACGTGCTGAAGCACGTAGGATCAGAGACTCGGCGTCCATACGCCCAACTTCTCG
CTCGTCCGCCAAGACATGACATGGCGAACGTGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCAAGTTCGACAAGCCAACGGAG
GAGAGGCTCGCCCTCTCTTCCAACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCA
TCTCGCTGCTCCCTCATGATGAATCCCAGAGCAACACCATGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATTACTG
TTGACAGTCGTTGGAGAGCTTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGTTTTCCATGGGCAC
CTCTGTATCCATGGGAAGGTTCTCAGTTCCGCGTTCGTGCGATGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACGAAGTGCTACCAGGTGTA
GTGGGCCTACTTTGGCTCACTACTTTAGCTTACACCTGTGCGCGTGTATGTGAGGAAGCGTCGCTTAGTTTAACTAGAGTTAATTATACTCGGGCCTCCG
AGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATA
TTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAAGAATCAT
AAGTCTCTATGGACCACCCGCCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTATTTCGAACCTCTAAC