Description :
From Genome Similarity Track
Location :
Scaffold_199:30666- 35471
Sequence
4805 bases(100 bases per row)
AAGTAAAAAAGGGAATAATCTCCTCCTGTGGATCAGAGAGGTGGAAATGGACATGAACTCTGCTACGCTCCGGTCGGAGCAACAGCGAGTTGGGATGGCT
ATCTCAAAATTGGGTGGTAGATCCAGAGAATGGGCTCTCACGTGTAGCACGTCGGTAGACGAAGCTTTCCCCACATAGGATTTGCTAAAACAGCAAATAT
CCTGGGTGTTTGCTCCGCCTAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGTCCTTCAGGGCAAGAAAGAACTATTGGACTATGTCCAGGAACT
GAGAACTCTAATCGCTGCCATGCAGCTTGATTCCTTACCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCCTTCGTACGGGCGTGTCTCGAACGGAA
GTATTCCAGGTACACCCCACCTCCTTTCAGGCGGCTGTAGATATCTCGTTAGATATCTCGTTGAACGCTGAGTTCAACTTCAAGGCAGCCCGTTTTGGCA
CCCATGGGTACAACTTAAACTCGGCGAGCTCCTTTAGTTCATTCAATAGGCCGGATCCTATGGACATCAGTCTCACCGAGACAGACGAAGAAGCAGAGCT
TCGAGCTGTAGAACAGCATCGAAACATTCGACGATGTTTCAAGTGTGGAAGCACGAAGCATCTACGACCTAATTGCCCTTTACGCACGCCAGGCTACTTC
AGGCCGAACTCCTGCCGCTAACCAGAAGTCTGGTACGGTGCGGGAAAACGTAGACTCCTAGTAGACGCGGGGCTCCTTGCTGGGGAAGAACTAGGTTTTA
TTGAGTCTCTAGGAGGTAGTTGCGAGCAAAATTTAGCCCCAAGGAGTCCCGTGCACTCTAATATGGGACGTGAATACAAGCCAGGCTTGTTGGTCGCAAA
GGCGACTGTTAAAAGCTTTGACAAACCCTGGTCAATTTTGATCGACTCCGGAGTATCCGGTAATTATGCCAGAAGTTGTTCCCTTGAAGGGAATCCACGT
TATGTTGAGGCCCTAGAAGCGCACAAGGATGATACGATCACTGTTCGCTTGGCGACAGGAACTCTAGTCACTTGGGTGTGAAGTGTTTCAATTTTGATCG
TAGCAAGCGCTATTAGTCCTTGATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTGGAGCGCCATGAGCCATGGATCGACTGGAGGTCGA
AAACATTAGGCGCCACGCGCACTGCTCCTAGCGGAGCTTTGGGGAGTCATGAACCCACCACTGCTAGGAATCAGAAGCACATTTGGCGCGAGCCTGGATG
GCAATGCTAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAGAGCAAAGCTCGATATGTGATAGTGAAGC
GGCACGTACTCCGCTAAGTAATAGTCGTTGTGAGAGCACCGTACTGAATTCTGAAAGCATTGTTGACCAAGAGTCAAGTCATCGAGGGTTGAACTCATCA
GATGAGCATGGAGTGGCGCGTAAGTACCCACTTGGTGACGTTGGCTGTGATAGCGATGCGCTGAATGTCAATATTGACGTTGTTGGTGAAATACCAAGGC
ATCCCGAGCCCGGATCAGCGAATGCACGCGAAGTGGCACGTAATCCACGTGATGACGACGTCATGCCCAATAACTCGTCAATAGATGCCATAAGCTTTAG
GGTAGAGCAAATTCAGACCGATGATGGTATTAATCAGAGAGATACGAGTCACACATCGTGTGCTGTGTCACAAAGTGATGATGAATGTCAACTGTATACA
CTCGTCCACGGAGTGACTGGTGCCTGTGATGGTACAATTAGCCTTGAGGCTATATCCTCGTTAATTTCGCTTTTAAAACTCGAAGAGTTGTCGGTCGATG
AGTTTGATTACTCACTAAAGAATGAAGACCTTTCAGAGGTGGTGGTCATTCGACCCGACATCATAGAGTTGAACTCTTCTTCACTTTTGGATGAAGCCGT
TCTGGGGGACACAAAAGCAGCACTCAGTGCGCATAGTGGATCATCAATATTGAAATACACTCATGATCCCTTTTATTCCTTAGTCAAGGAATTTCAAGAT
GTGGTGTGCCGAGATATACCCTCTGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCGGGAACGAAATACAGTGTCACACTGTCGT
GTGACACTGTATTTCCCTTTCCTAAGGAGCAATGTGAGGTCATTGATGACTTCTTCCGTGCTAAGCACAAAGCAAAAATGGTACGTGAGAGTAAATCACC
ACATTCGATACCGACATTTTCTGTCTAAAAGCCGAACGGCAAGAGGCGTATTGTGCATGCTTATAACAAGCTTAATGCGGCTACTATTCCGGCATAGACA
CCCATTCCGTGAAAGGATTTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGTTGATGGATACTATCAATTGGTCATGCGAG
GCGAGTGATATTCCGCTTACAGCAGTTAGCACCCTGGGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATGCTCCATTTAATCGTC
TGGTGACGCAACTTTTCCGCCCACACCGGGATTACACACAGACGTACTTTGATGACCTTTTTTTCCACAGTCGTGCCGAAAACGGTCGGTCAGATGTTGA
AAATCACATTAATCATTTGCGAGCTGTGCTCGAGCACTAATAAAGTGTACGCCAACGCGTCTAAATGCATTTTTGGTGCAGAAAGAGATTTTTTTTCTTG
GATGTTTTATTGGTAAGCGCGGCATCAGAGCGGATCCCGCTAAGGTCAAGGCTATAGTGGACTGGCCGATTCCTAAGAATCAAAAGACTTGCGTAAGTGA
CTTGGCCTTGCCAATTACTTACACAAATACAGCTAAAATTACGCTGGTATGGCTCGGCCATTAACCGATCTCCTTAAGGTCACAGATTGGCACTGGGGCA
AGAGTTCCATGATAACACATTTCGGGCAATAAAGAAGAGTCCCCTCAATGCTCCTATTTTGGCGTTGCCAAATCCGGAGTACTCTTTTAGAGTTGTCTGC
AATGCATCCGACTTCGCCATCGTCAGCGCCCTGTTACAAACAGATGCTGTAGGCCTTGAGCTAGTGATCGCATGTAAATCTCGTCAGCTGAAGCTGGTGA
AAAGAAATATCTAGTTCATGACAAAGCGATACTTGCTATGGAGTATGCAATCGTCATATTTAGAGTTCATCTGCTTGGCTCTAAGCCATTCGTCGTTTAC
ACCGCTCATGTGTCATTACGCACGGCGACACAGTCGCCTCGCCTCTCTCAGAGAATGGCTCGTTGGCTTCTTTTCGTTGCGGAATATAACTTTGAGGTGA
AGTATAAGCCAGGCAAACAAAACGTGTTGGCAGATGCCCTCTCTCGCAGACCTGATTATGAGCTTGCTCATGTAACGACTTTGTCGTCTTCTTTTGAGGA
GTTAATTCGTGTGGCCTATCCACGGGATCCTCAATGTGTAGCATTGTTTCATGCCCTTGGGAGTTAGAATTACAAGGACTCGGACAGTCAATTATCGGCA
CGCTTGCGGGCAGGCCTACATCGATATTCCATCGATAATCGACTTTTGCGCTATCGCACATATGTAATGGGTACCGCTCGCATTGTTGTGCCTCACAATG
AGGATTTTATGTGTCGAATCCTCTTTGAGGCCCAAAATACTACCCTCAGTGGGCATTAGGGCCGGGAAAAGACTTATGGCTCTGTGATTCAACACTACTG
GTGGCCCAAACTCTACAAATGGGTGAGCACATACGTACATGCGAAACGTGCCAGCGGGTAAAACCCTCGGCACATTCAGCTGCGCCACTCGCCAGTTTAC
CTGTACCCACGGGGTGTTGGGAGTCCATCTGTATGGATTTTTGTTTAGTCTTCCCAAAGACAGTAAAGGCAATACGGGAATTGTGGTCTTTGTTGACCGC
TTAAGCAAGATAGCTCACTTAGCGGCAGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATGCTTTCTATCGATCGTGTGTTTCGTCAACACGGGTTGC
CACTGGCAGTCATCTCTGATCGCGACCCTCGCTTTACTGGCAAGTTTTGGACTTACTTCTTCAAGGTTCTTGGCACGCGATTGGACATGTCCACAGCGGA
TCATCCACAGACCGTATAGTCAGACTGAGCGAGTTAATCGCGTCATTGGAAACCTTCTTCGCAGTGTTTGTGCTGAGTCGCCTAAGACTTGGAGCTCGAT
ACTCTCTGTCAACGAGTTTGCGTTGAACAACGCTGTTCATGTCTTGACTGGCTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGCGTTCCGCTC
AAGTTACTACTACGTGGTTCTAGGCTTGGTGGGGAAGTTTCTGCTGACAAGCTTGCTAAAATCAGCTCTACCACGATGCAGAAACAAGTAAACGATTTTT
TCGCGACGCGCTTTAGTGTCTTACGACATGTGCGTGATGCAATGGCTGATAGCCAAGACAAACAAAAGGAAAAAGCTGATATAAAGGCAGAGGATGTATT
GATTCTTATGAAGTTGGAGACCAAGTCTAATTAAACGCTAAAAACCTACCTATAAATGTAGTGTCTGCCGTAATTGCGTCCGTGATTCATTGGGCCGTGT
ACGGTCATAGCGAAGAAAGACCTTGCCTATACACTCAATCTCCCGGGCAAGTTGCGCACACACCCAGTGTTTTAAGTTGGCTTGCTTAAGCCATATCATG
ATCCT