Description :
From Genome Similarity Track
Location :
scaffold_37:30666- 34364
Transcript NameFunction/comments
Pl_111486Di-N-acetylchitobiase, putative
Pl_111487hypothetical protein PHYSODRAFT_490132

Sequence
3698 bases(100 bases per row)
CATTGGCCGCCGAGTAGTCCAGCGTGTCTGCGTTCCACATACCCACACCGCGCAGCCCGAGCTCCTGGACAAGTGCGTACTTGGCCTTGAGGCTGCGCGG
GTTGTCGAACCATGTCTGAGACCGCCCTCCCTCAGGCGGCGAGTACCACATGAATGGGCTCATCGTCTCCGAGTCCCAGTGCTCGACGAGCCCGTGCCTC
CTCACCAGTCGTCGGACGTCTCCGTAGTCGATCTGTCCACCAGCCGCGTCACTGCAAGGGGCACCAAAGAAGGGCACCGGCCGGATCTGGCACCACGAGG
CATCGTCAATTGCTGTGGCGCCTGCCAGACACTCGTAGCGGTAGCCATACCACGGCACCCCGAGCACCAGCTTGTCTGGCGCGACGTCGAACGCCAGTAG
GAACTCCTGCAGCCCTTGCTTCACCAGTGCCAAGGGCGAGTTGGCGCCTGCAACGCACGCGTCGTATACTTGGCTGCGCATGTCATACGACATGACGAAC
AAAAAATCCGTGCCGGCCGCGAGCTCGTGCCATGGGTAGTAGCGACCATCCACGCCACGCGGAGCCCATGGGACGTCAAACGTGATCTACGCAAGTCAAG
TGTGGCAGATCGAAGGGGTCAGCAAACGAAATTGGTGTAGCTGTCAACAGTGAGAACGAACCTGCGCGTTTCTGGTGAGTGCATGCTGTTCCAGCTCATG
ACGCAACTCGTGCACGAGCAAGCCAAGACAGTGTGAAGTCGCACCGTACATAGGCTTCTCTGTGTCGATATTCACGCCGTCAGCGTAATTCTGTACGATC
TTGTTATACGCCGTCTGGATATACAATCAGAATTCAGTCGTAAGCATCCACGAAAGCACAGGTGAGCCAACACACCTGGATCCAATCCTGTCGTGTTGTG
ACGTTGCACAGCTGATTCACGTCGTCAAAGTTGTGCTTCACCACAACTTTGACGCCCTTACTGTGGGCATGACAGAGCAACTCCTTATCCTCGTTCCAGG
CCACTGTCGTGAGCTGGCACTCAAATTCTTAGTAGCGCAACCATCATCGTTAAGCGTCCAGCAGTGTGTACCTGGTCCCAATCATAGTGTTTCCAGCGGT
CATCTGTCGCCACGGAGAAGGCAAATACTTCCTTCCTGGGCTTCTTGCCGGCAAAATCGACTGGCAGACACAGTGAGTTGATGAGGTCGGCATTGCTCGG
GCAAGGGCAAGCGCGCAGATGAGCGCGGTCTTCCTGAGTCATGGGGCCTACGAAGAGTCCCTTTGCGTCGTACACCGGGACAGTCTGAGAGACGCATTCC
CTTGTCACTACCAGCAGCCCCAGCGCGACCACAGCAATCGCTTGGGGGAGCAACATTCCAATCCTCACGTTCTGTCTGATTCTTCGATCTGATTACAAAA
ATATCAAAAGATCGAAAGTATCTTTCGATGGTCGACCTTCACGCCTCTTGGTGCGCAATAGCCACTTGCAAGGTACAAACAGCATCTTAAGGCCATGGCG
AGGACCAACAGCGCGCTCATGATGAGTATGGGCACCGTCAACATGTGGGGCTTCTCGCCCGCCTTTGACGTGTGTACCGGTCTTCCTGAGTGGAACAGCC
ACAAGAACAAGGATTTTGCTGCTACAGCCGACGATAACGAGGAGAAAGTGTTTGTGGAACCGATCAACATACTACTGGCGGGACCTGGAGACGTGCGTCA
CGTGCTGGCGACTATCGCACGTCGTCGTCGATGGGAGCCCGCCATGAAAAACCGACCGGTGAACATTTTTATCCTAGAAAAGCCTATTGAGACGCTCGCG
CGAGACTTGCTGTTGATTCAAGTTGCGCTTGATTCAAATATGCCACTGCGTCAACGCTGTAACTCGTTTCTGGAGATATTTGGGAATGCCCGGGTGCAAG
TACGTCATGAAGGCTACCGAAACGTGCACTTTTGTAAAGGTATCCACTAACTGGTGTTCTGTGAAGGAGAGAACAAGTACGTACATCGAAGAGCAGGCGA
AGGTGTTGATGGATTTCGTCTACAACAATCGCGGTCCATTGGCAGGTCTAGTGGACATCTCACATTTGAAGATGCGCACTCATGACGACCTCATCGACTC
GTTCCGAAGCTGGTTTCTGAGCGTCAAATTCGATGGTAAAGTTGAGGTTGGATCGACAAGGATGGTGGATTCTAATAAGAGGCTGTGTACTTGTAGTTGA
TTCCCTCCGAGATCATCGGCTTCGTCACTACTACGAAGTTCGCTACGACTATCGCGACAACTTGATCGACTGGGATTACACCGTGCGTCATGCAAACCGT
AGCTTGACATGCTCGAGTGCAATGTACTTACTTGTGCTTCCACTACAGATGAATCTCAAGAAGATCGAGAATGCTAGTGTAATTCATATTCGACAGTATC
GTAACTGGAGAAACTCTGGTGTGGCGTTTGAATTCGGCGACCAAATCTACTCCGTACCAAACCGCACAATGGCATCATACACGGAGGTAAGACCTTGGTA
CCAATGCATGGCGAAATTGAAGGCAGGTCTAACCGTGCTGGCACTGATGCGATATCAAACATAGGCAAAGAAGAAGCACCACGGATCTGTGCTGTGCAGA
GGCTTGTGGACTGACATCATCGTGAGCCCATACATTTCGTTCGGTGTTCACTGTGATAAGTCCAACAAATTCGTGGAGGGCCTCTTCGAGATTCACAACA
AAGGCGCCGGTGTTGAACAGAATCGCCACGTACGTGTCTGCTTCGACGCTAACCTGATGTCGCGAGTCTATCTACATACTCACCGTTCAACATTTCTCGC
AACAGAACACGGTGGAAGTTGCTGTGTACAACGTGCTATCGTATTTGTACGAGATCGAGACGGGGACGATGTATCAAATGGAAAAGGTTGTAAATAACTT
AGTGACGTTAACCATTATTTTGCTGCTGTTCTAAAGTGACTGTCCGTACCAGGAGCACGACATTTTCAGTGGTATTGGTGATGTGCAGGGGGCATGCGTT
GATATTGACAATCAGCCAGTAGAAGGAGAACCAACCCCACGGTTTGAAGAGCTTCATGATGACACCAATCCCGAAATGTAGGTGGTTGAAAATGCTTTGC
GCAAACTCATCTGACCGTTATCGCTCTCAGAGAAACCCGCAAACAACAAACAGCAACAGGTGAAGCTCAATGGCGCGGTGAGACCATTAAACAACCTTTG
CACGGCGTGAAGGTACTACTGCTACAACACTACTGCTACAGCGTTCGAGGACTCCATTTTATTCACTACAATTGCTACTTTGCAGATCATTCCGATTACA
GGGAACATGGATGATTTGTTTTCAAGAAAGCGCTACGCAGGCCTCTTCGACTATGTCTTTATATCGTCGCAGCAGTGCCACACGCTCCAACCTTCTGGAA
ATGTAGAGCAGCAAGTGACACCGACATTCACAAGTATTTTGAAGGACGGAGCGATCGTAGACATTGAGTCTTCTGTGTAAGTACATGCTCCCATGACCAG
GCAAATGGGCAAAAGAATTGATTTTGCTTGGCCACGTAGGTTCATGCTGCCTCTCAAAGAGGAGCAACGAGCACTTTATGTGACGAAGCTACAGGAATGG
ACCATGCAGTATTCGCTGAAACCCACGTTTGACTTCCGTGGTAAGAAAGACCCTTCTAACGATGACATGACCAAGATCAAAAACACAGTGCTGCGGTT