Description :
From Genome Similarity Track
Location :
Scaffold_60:30650- 35281
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_60-fgenesh-gene-0.7Argonaute1 (AGO1)
Pytve_DAOMBR484maker-pve_contig_60-fgenesh-gene-0.17WD-40 repeat-containing protein

Sequence
4631 bases(100 bases per row)
TCGAAAGCGTGCAAGCGGCGCTCGTGCGACGTGTCCTCGCGCTCGCCATGCACGTGCACCATACTCGGCTCAGCGCTGGTGCTCTCCACGCGAAGAAGGC
CAAGAAGTCGCGTGATCTGGTCAAGTCGTGTCTCGCGTACGCGCATATCACTGCGCCGTCCGTCGAACGAGCGCTTGTCAAGCTCGAGCTGCTCGTGGAC
GCCGCCAAGGTCGCGCTGGTGACGAGTTGTTTGCCGCAGATGGACTCTTTCATCAAGGCGGCGGTCGTTCTCATCGCCGAGTTGGACCTCGATGCACTGT
TGGCGATGTCGACTGATGAGGACGAGGAGCCCCACAACATCGGTGACAGTTTCCGCATCAACAGCATTGGGCTCACCCGCTTCGAGTACGGACTTGAGTT
GCTCGTGCGCATCACTTGCGACCTTGTCAGCGTGCTCATCTACGCGCCATCGCTGACCGATAGCGATGCCTTCTACTTTGTTCACGCGCTGCGCAAGGCG
GCGCTCGAGAGACTACTAGTCGTGCAACCGTCAGCGCATGAGGCGACGATGGTGGCGATCGCAGCGAGCCGCGTTCGGATCCAGTTTGCGCTGCTGCAGC
TTTTGGCGCTTTGGGGTCAGCCGTCGCTACCTGATGGACGAATTGGTGGCGTCGATTCCAACGACGTGCTGTACGGTGGAGACGTGTTGTTCGCGCGTCG
CGTGCGGGAGGAATTCAGCACGACGATCGAGAACATCGTGCGCGAGATCGAGACGCTGGGGCAGATTGATGACGATGATAAGCAAGCACCAGCGCAGCGC
ATGGACCGAGCGATTGCTACATTGCAAGCAGAGCTGATGCTAGACTTCATCAACCTCGCGGCACCATCGCTCGCTTATGCAGAGATTGATGACGCTAGTT
CCGACCCACTCGACGACGAAGCCAAGAGCGACGTGCTGGACGACGGTCAGCGGCGCCGGCGGCGACGAGCACGTAGTAGTGCTGTGCTGCTGCGTAAGTG
CTGGCTGTTCGTGAGCTCCAAGCTCGACACGGCTCAAGATGCAGGGTCAACACGATCGATCAAGTCTGAAGGGACCAAGGAGAGTTCGTGGCTCGAGGAG
TATCGAGAGAATACGCGCGAATTTGTGGCCCAGCTCGCAACGACAGCGATGGCTGCGACGAAGTGGCAGCATCCGTCGTCGTCAGCGCACGTCCAGTCCA
TCGAAGCACTGCGAGCCGTGCTCAGCAACCGCGCGACAGTGGGATGAATGTTGATTGTATTGAGGTTATTCACCAGCTGACGGGTCTCGCGTTGGAGGCG
CAGCTACTTCTTGCCGCCCTTCTTGCCGCCCTTCTTGTTATCGGATGGCGCCTCCTTCTCGGCCTTCTTCTCGACCTTCTTCTCGGCCTCCTTCTTCTCG
ACGGCACCCTTCTTCGGCGGCATTCTGTGTGACTCGACGAAGCTTGAGGGGTCCGAAGCAGATCCTTGCAAAAAGGAGAATGAGTACTGCTTCGCAGAGC
TCATACCTCTCAACCGCCGCCACTTGCGCAGCGGTTTTGAGCTGAATCAAGCGTCATCTCTCTCGGGACTTTTGGAAGGAATAGAGAGCTCCAACAACGG
CCCCAGTCCTCAAGCGTCAGGAGGAGTGTATTGTGAGTGTGATGCGAAACGATCGTGGGCTTACGAGAGCGAAACCACTGCCGCATTCAAAGTCAACGGC
CCCGCATCAAAGAATGGTGCAGACTAACCACCGCGGCGTCCTATCGGCGCCATCTTGAATTAGCGATAGCGCGGCGGAGGGCGGTTGATGCGTTTTGCAT
CGTGCCTGTTCAAGATCGCTGCGTTCCGTTCAAGAGATTCATACTGCGTTTATAGTCCCTTACACGACTTTCGGAGCACATTCCCTCTGTTGACGAGGTT
CAAATCTCTATACAACGCACTTCAACTCTCTCTACAAGGGGATTTCGCGCCAAAGCTGCAATCACTCAGAGGCTCAAGCAACTCGTCGCTCCGTTTCTCG
CGTTCGTTCAAGAAAAGCCACAGTGGCTCACTGTGCGGAAACGGACGCCGCGCCTCGCAACGACCCGAGTGTGCCGCACCTCAAGATCTCGCGGTCGCAC
GCTCACATTCCAGTCATTCATTCCCGAACGTGCGCGCTCGCCCACACAAGCCCCAAGACTTAGCCTCAGCCCCCTCAGCGCATCATGCCGCCGAAGAAGA
ACGAAAAGAAGGAGGCCGCCACGGACAAGAAGGTCGAGAAGGAAGGTCGGTACTGCTCGTATATTGTGTGCTGCCCGATATCTTGAAGTGAGCTCACTCG
CATCTGCACGCAGCCGCTGGCGAGAAGGGCGGCAAGAAGGGTGGCAAGAAGGGCGGCAAGAAGTAATCCCGACTCGTCCTATTACCAACGCGGACGCAGC
CGACCACGCCGCCGTCCACGGCGCTGCGCTTCGCGGCTTCATATTGAGAAACCGGCAGAAACAGACGGACGGCGGCCGTAGGATAGCGAGACGGTCGAGC
TCCGAGTAATACCCAACGCTATGCTGCATTGACCGTGATGATTTCGCTCCTTGATCTGCTTGAACCGAGTCCTGAATCGTAAATGGGAGCTCCTGAAAGA
GCGGGTTCCCCCTTCTGGTCTTTGTCGACCTTGAAGGTGTCGGAATAAATGTCTGGAGATGTCTGTAATGCTTGCGCCGCGAGCATCCATTTCCCAATTG
CACCTATCCTAATTGCTAGCCAGCACCTATCTATCGTCTTCGCCGCTTGTGACTGCTGTTGCCACCCGCTGCGCTCGTGTTCCGTTTGCCGCTCTGCGTG
GCCGGCACCGGGCCAGCAGCACCTGTTGGATCTGTCACGACCTGCTCGACGACTATGCCAGACTTGCGTCTCGACCTCGACGACTTGGGCTTCTGCGGCA
CCTTGAGCGGCTCGAACACGCTCTGGCCCAGTCCAAAGTGCCGCTCGTCGTGGTACACGGAACCCTGAAACGGCTGGTTGTGCTTGCGCTGGTGTTGCGC
GATTGGGATCGCTGGGAGGTACAGGAGCTCATTCTCGATAGGCGCTAGTGAAGGGAACACCACGGCGGCACTGTCGTCACTATCGATGACTGGCCCGTGG
CCCTCGAAGATATCAATGTCTTCCTGCTCGCTCTGTTGCGCGGCTTGCCGCTCTTGGTCACGCTCTACAGCATCTTCCACGTCAAACGACTCGTCATGGA
GCTCGTTGTCCGTGATCAGCCGGAAGCCCGCGGGGTACATGGAGCCAGGCCATGTCGTTGTGAACTCCTCCTCAAACACATAGAGCGCGCCGGTCGCCGA
GACGGCGATGATCGCGTCCCGCTGTGTGTCCCACGTGAGCGAATTGACGCCGTCCGTGACGCCGGCGTTGTGCTGTGGCTTTCCCGTGGCGCAGTCCCAC
GTGTACAGCCCGTTCTCACCAATGTGCCGGTGGCGCACGACCGGCACGCCGACCGCAAACTTCTCGTCGCCTGTGAAACTGCACAACGCCCACGGTGCGC
GGACAGCCCCAGTCGAGAGCTGCCACACCTCGGAAAGCTCGCGTGCGCCGGTCTCGGGTTGTGTTGATGGTCGCCGGATCGCAAACTCGTGGATGCCCTT
GGAGCTCGTGATCAGCAGCGCCGTCTCACTGCTGTTGACGCAGATGTCGACGTACTGAATGAGGATGTTGAGGTCGATGTGATTCACTCGGGCTAACGTC
GACGCGTTCAGGATCGCCACCGTGGCTTTGGTCGTCGCAGCATAGATAAACTCGCCCGATTGGCCGTACCGCGCCGCGACGATCAGAGCGGGATGCCGCG
AGTTGCTCGGGATCGTGATCGTCAGCATCGAGTTCTCGAGCGGAATCTCGTTCAGCGGTGTGGCCTCGCGCGTCGTGACGTTCAACAGCACTGGCACGCT
GTTGTACGAGCTCACAAGCACCTGCCTCGGATCGCTCGGGTGAACGCTCAGGCAGTTGATAGCAGCGTCGAACGCGAACGTGGCCACAAGCGTCGACGCC
TCGACATCCCAGACACACAAGATCCCCTTGCGCGTGCTCTTCTCCTCGCAGCCGGAGAAGACCCAGCGCGAGTCGCAAGACCACGCGACCTGCGTGACCA
CCTTCAGCGAGTTGCGAACGCGCCGCAGATCCGTGACTGATAGTCCAGGTTCGACGATCCCGCCATTGCCATTTCCACTAGCTACTGGAGCATCGCCGCT
GCGAGTGACGGATCGCGTTTCATCGTCAGAACCGTGGTGGTCGCCGTCGTCCGCATCCTCATCGTCTTCCTCGGTGCTGCCGTCGCCTTCTTCGACTGAA
TGGCCGTCATCGTCTTCGACCGATGCGTCCTCATTGCCTGTCGAGTAGTCGTTTGCGTCCCCACCATCCTCATCCTCATCTTCGTCATTGTGGCTCTCAG
TCTTGGAGAGACCACCTCGTCGCTCCGAGTTGTCTTCCTCCTCCCCCGACTGCCCGTCATTTTCGATGTGCTTCTCGTCAGGAACGACGATCGACGTCGG
GTCCAACTCGCGCGTGATGACGCGCAGCGACACGTTGTCCCAGATGCTCACGCGGCCGTCGCGCTCGCCGACCGCGAACATTGTCTGGCGTCGGTTGAGT
GCCACGCAGTTCGCCTGCTGCGCGTCCTCGA