Description :
From Genome Similarity Track
Location :
Scaffold_26:30631- 31933
Transcript NameFunction/comments
Albla_Nc14029430myosinlike protein putative

Sequence
1302 bases(100 bases per row)
GTTGTCCTTCCACGCGATGAATTGCCATGGAATGCCTTCCTGTACGTATTCCTGCTGCTCGTAGGAGATCATTTGCTGCATGAAGTGCCACTGGAGTTTC
TCGTTCGCGTAATTAATGCAAAGCTGTTCGAACGTATTCACTTGAAAGTTTTCAAAGCCGTACATATCGAGGATTCCAATGCTTCCCCATCGATCCGTTG
TGGAGACGGACTCATTGACTTTGGACAAGAGCCATTGGAACGTATTGGCGTACAACGCTTTCGCGATTGCGTCGCGTTTATCGCAAACTTGAGAACTTTG
TTGTTTCTGAACAATTGTTTTGCCATCCACAAACATGGAGCGAGTCAGCAAAGCCTTTTCCAAAGCCATTGCGTTGATTCCAAGCAGTTTGGCTGCATGA
TGGAGTGTCTGATGAGCCATTTCATCGCGCAGATAGGTCGAATCTTCGGCTGATCGAAAGCTCACATTCCCGAGGTGCAAAATTGCTCCCAAAATTGTAA
ACACAGCGGATCGATTCAATGCCGAGATGCTCAAAGCGGACATGCAATCGATCGTATTGGCAAAGCGTTTGGCGTCATCACTGCAGGAAAGCGTCAATAA
TCACAACGCAAGACAGCACATCAGCCTACCAGCCTGGAATCCACGAGCAATCGGATCGGAGTAGCACAAACTCACGCGGTGACCCCAGCTTGAGTCGATT
TCGCATATCTTCATCGGCCCCGGCCAAAAGCTACAGATCCAATACACTAAGCAAGACAATATTGCAAGCTGTCAAGACCCCACCTGATAGAAAATATGAT
AATTTCGCTCGTCATCATTCAACGCAACAATTCGTGTTCTCTCCAGCAAAAACGAATGAATCTCAGCGCCAGTCATTTTCCCCCGGGCATTGAATTGTAT
CTCAATATACTTTCCAAATCGACTCGAATTATCATTTCGACTGGTTTTCGCGTTCCCAAAGGCCTCGAGTACAGGCTGTGCTTTCAGAACACAGGCCTCC
AGCAACGTGGGAGGCTGTTCCTGCTGGAATGGAGAGGTGCATTGGGTCAGATACTGCATGAGGTACTTCATGGTCTCGGTCTTCCCGGCACCGCTTTCAC
CAGTTATCAGGATGCTCTGATTGCAGGGTCCATTGGGATCGCGTAGTAGCTGCGTGTACGATTGCTGTGCGATTGCAAACACGTGCGGAGGGAGGCGATG
CGCTGTATCGGTGCTGTATTGAGTCATCCGTGCTCGTGTGTACAGCGCCGGGAGCGAAGTGTAGGGGTTCAGCGCAATGAGAATGGGTCCCACATTTGTG
TA