Description :
From Genome Similarity Track
Location :
Scaffold_933:3063- 8067
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_933-snap-gene-0.8Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_933-snap-gene-0.7Kinesin
Pytar_ATCC12531maker-par_contig_933-fgenesh-gene-0.3NADPH:adrenodoxin oxidoreductase

Sequence
5004 bases(100 bases per row)
CTGCGGCCGTACGTGCGATAGTCCGAGACCAAGTGGATGTGGCTGGCCAGCTCCGTGTGGATCTCCTTCACGAGCTGCAGGAACTCGGTCGTCGCCATGT
TGAACGCCATCGTCGAGCTCTCTTCCGACGAGCGGCGCGGCGTCAAGTGGTTGATCGCCGTCGCTGCCGTGCGCAGCGCGCTCACGATTTTCTACACAAG
AATCAAAGTCGGAGAGTTATTAGCAAACATATTTACGCACGCCTTACACGCTTGCGGACGCCGGGAAAAACAGATTTAAAGAGCGGAGACGCACCTGCTC
GACGCTGCCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGGCGGCATGGCGCGAGCCCGTGAATGGGTCGCTGTTGTCCGAG
AAGTGCACGCGGCCGTCGAGCTCTGCCTCCATTATCCGTCCCTGTATTGCCGCCAACACCAGGGTATGTACTGTGAAACCTGTAATATAAGATAGTCATA
TTTGACTAAAAAGGATATATATTGTATAGCGGGGGTATCTGTTAGTGCGGGTGTAGCCATTGTCTCAAACTTCAACCTCAAGTAGCTGGGACTATTTTCT
GCCCACGACTACCTGCTGCCTCCCCTGCTCCCCTCCTTCACCCCATTAACATCAGCGACAGAGCGTGTGGCGCGTCGACTGGCTGGCTGTGTCATTTCCC
CGAGGGCCACAAGCCGTCCACCAAAGACAATGGACCACAAGGTCACGACCGACTACACGCGGCTGCTCCACAATGCCAATGTCAAAGTGTACGTGCGCGC
GCGGCCGTGCGCCGACGGCAGCGAGCCACCCGAGGACATGTTCGAGCGCAAGCGCGAGACGCCCAAGAACATTGTGATCAAAGACACGGAGCGCATGCAG
TACGGCAACCACGCGTTCTCGTTCGACTACATTTACTGGACCGACACGACCCAGCCCGAGCTCTACGAAACGGTGCATCCGTGTCGATTCTCTCAAGTAC
TTGTGAGGTCGCTGACTAGAGGGCGTTTGTGAGTGTGGTAGACCAGCAAGGCATTGGTGGACTACGCCCTCAAGGGCATCAATAGCTGCTGCTTCGCGTA
CGGACAGACGGGCTCCGGCAAGACCTTTAGGTGCGGTTGACGGATGCTCTATATGATCCTTCTTCTCTCGCCCACCAGAGCTAAGTAGGATGCTATCGGC
AGTATCTTTGGGGAGGCTGGCGAAAAGGCCGGACTGCTGCCGCGGTCGATTGAGTGCCTCTTCGACATGATTGAGCGCTCCGACGGCAAGACCAAGGTAC
GAAGAACGAGACACCATGACGAGATTGGTCACCCTCACCTCATGTCGGGATGGCTCTAGGAGGTCACACTCGCCGTGAGCTTTCTCGAGATTTACTGCGA
CCGCGTGCGCGACCTCGCACGGGAGTACCTAAAGAAGTCGGGTCGCCCCGTGTCCTTTCAGACCTCGAGCAGTACCGACTGGTTTCTGCGTCAGGTAGGA
AGTTCCGACTACACCCGCTTAGAAGCGAATCTGACAACCAATCCTCGTTGTTCTGTTAGCGCGAGATGAATCGCAGCGAATCCGCCTCTAGCTTTGGATC
CAACATCGCCAAGGGCGACGACAATGACGACTACGAAAGAGGTGGGAACCTCACCAGCACATACTGAGACGGCTGAGTCTAAGGTGAATTCATTCCTTTC
CAGCCAATTTCGAGATTCATGAAGACGCCCAAGGTCGCGTGTTTGTCAAAGACCTGTCCATGGCCACGGTGACGACGCGGGAAGAGGTGGACGCGCTCGT
GCAGGCCGGTCTCAAGCTACGTGCGACCCACGAGACCAAGATGAACGCCGTGTCGTCTCGGTCCCACACCGTGTTTACGATCCACGTCTTCCAACAAAGT
GAGTTAGCCCGCTGTGGTGCTGAACAATGATGACGATGGGCGAGCCCAAGCATTCTTAAATTCCGTAGACCTCGACACGGACGAGATCGTGTACGGACAG
CTCAACATGGTCGATCTCGCCGGCTCCGAGCGGCTCAAGAAGAGCGAGTCGGACGGCCAACGGCTCAAAGAGGCGCTCCACATCAACTCTTCGTTGAGCG
CTGTGGGCAAAGTGGTCATGTCGCTAGACCCCGAGAGCGGCTACAACTACATTCCGTACCGAGACTCCAAGCTCACGCGGCTGCTGCAGAACAGTATCGG
CGGCAATTCGTACACGATTCTGATCGCGACGATCCACCCGATGAAAGAGCATTATGAAGAGTGTCTCTCGACACTGCAGTTTGCGAACCGCTGTCGCTCC
GTGCAGAACCAGCCACGTGTGAACCATATCAATGGCTCGGTCGCCGACAAGGACCGCCGCATCCGCAAGCTGCAGGAAGAACTCGCGCTGCTGCGGCGCC
AACTAGAAGGGCTCCGTGCCGAGTACAATAACCGGTTCGTGCGCATGCTGAATGAGCTAGGCTTTGACGCGGAAGAGATCACTGAGAACGGCGAGATCAA
GTTTGCGGTGCGATTATCCTTCCATGATTGGTAACGGAAGGTGTCTGCGTGTTGGCCTCACTTTCGTTGCTGTTTGTCAGGACGGCATGGTGTTGAAGTC
CGTGTTTGCGGACGGCGAGAGCGAGCCAGGCAGCTCTGGTCCTACTATGATTCGCACGGGCGGACTCTCGCCTCTTGCTCGGGTCCACGCCCACGCCCAC
GGACCGCACCACGCAACCCTACGTAAGTTCCTCCCCACGTGTACGGTCGGTAGACTCTCCCGTATGGGCTAAGCCGAGTCTGCTTTTGTTAGAGTTATCG
AAGAGAGACCGAGATCAGTTGCGGCAAAAGTACGCAAACGCCAAGACCAATTTCAGTGTCGTCGTGGTGAGCACTGAGTGACCTTGCCGTCTCTCTCGAT
GCATACTCAGCTGCTGAGACTGTGGGCTCTTGACAGAGTGAGGCCAAGAAAGACAGAGAAGAGTCGCGCAAGTCCATCAATGAACTGCGGCGCCGCATCA
CACAGCTCGAGGACGCGCTCGCACAGAAGTCCAAAGAGTTTGAGCACGCGCTGACCGCAGAGAAGGCGAGACACCGCTTCGAGATCCAGCAACTGCTTCT
CAGCAGTGCAACAGCCACACACCGAAAGCAGCCATGTCAACAGACCTTCACAACCGCAAAGCCTCCCCGTCCGTCCAGTGCAATGGAGGACGAACAGGCC
GAGCAGCGCCACCGCCAACGGATCGCCGCGTTGGAGCAGGCCAAAACCCACGAGATCGCTCTCATTCGGCAGCAATATGACCACGCGATCAAGCAAAAGC
ACGACGACGTCGCAGGTGTGAGAGACCAGCTCGATCGCCTCCAAGCCACGACGACCCAGACCGTCGAGGTGAGACCCCCTTGTCCGCTCGATTGAGTGTC
TTGCTGACAATTATTGTGTGGCCCGACAGAATTTGCGTGGCGATTGCGCCGAGTTGTACGCGTACGCGGCTCGGCTCCAGCACGCTCTCGAGCAGGCCCA
GCGGTTAGGTTCTCCCGTATTCACTTTGGTACTTCGGCGTGCGTCTCACTCTATTCCTACTTGCAGAGGCGTGATTATCCCCATGCCCAAGAATGTGCTG
GCCGATCAGCATAAACTGCGGAGCGTCAAGGCGCTGGTGAGTCTTAGTATTCACTCTGCTATCTGTAATTACAAGCCGCTCACTGTTCTTTCTAGCTTGC
CACAGACACAAAGCGTCATTTGAAGCTGCACCTCCACCACGCGGGGATCCACCTTCCAGTTCACAACCATAGTACCAGCGGTGGAGGCTCCGTGATCTTC
CAGTCAGCACCAACTCTAGTCGGCAACGACGGCAGCAGCACTAGCAATGATGACGTGAAGCCCTCAGGCATCAAACTCGGCCAACGTCCCGTGTCCGCAC
CCGTGAAGCGATCCAAGGCCACGCCCTACGCGTCCATGCTACGCGACAAGGTGCGCGACCAGCCCACACAGAGACAGCGATAAGCCGTCGCCAGCCCCGA
CTCGGGATCTTGTAAAATACAAAAGTCTCGTGGAGATATCATAATCCCCGTGTTAAACTTAACCACCCTGTCTATTGCTTCGCCACGACCGCGAGCATCT
CGTCGACGTTCGTGATCTTCTCGCGGGGCTTCCCCACGCGCTGGCCGCGTTGCTCTTCCTCGGCGTGGAGCCGCTGCACGTCTTGCCAGTCCAAAAACTG
CGCGTGCGGGTGGCGCGCTGCGACGAGACGGCGGATGGCCTGTAATCCTTCCGAGTCCTCAATCGGCTGCAGCAGCGACTGCTTGGCTGCGTCCTCAAGA
ATGCACGCGACGGTCTCTCGCGCATCAATAATGTTGGAGCCGATGATCCCCGAGGGCCCACGCTTGAGCCAGCCACTGCAGTACAGACCCGTCGCCTGGG
CTCCTTCCGAGCTCATGACGCGGCCCTGTTCGTTGGGCACGACGTGGCGCTTCGTGTCGAACGGCACGGCCCTATCAATGGGCGTGGACTTGTAGCCAAT
GCTGCGCAGCGCGAGTCCGCACGGAATGTCCTCCATTTCCCCCGTGCCAACGGCGCGTTGGCTATTGGCGTCTCCCTCGAGACGCGTCTTCTCTACGCGT
ACGCTTCCCACGGCACCAGGCCGTGACGGGTCCTCCGAGAACGCGACTGGCGACGCCAGGAACCGCAGCTCGATCTGGCGCTCGGCGTTGCTGTTCGTGC
CATAGCTCTCAGCGACCTTGCCCAGCAGCTCGTGCATGCGCTTCTTCGCGCGCTGCTCGCCAATCTCCTGCTTGGAGGCATCTGTGAGACCGGCGGCCAT
GTTCTTGGGGTCCACGACGCACGCGGCGCCCTCGAGCTTGGTGATCTCACGCACTTCTTTCATCGTGAACGCGGCCTGCGCCGAGCCGCGACGCCCGACA
ACGTACACCTTTTTGATCTGGCTGCCGGATGGAAACAAGACAAAGACATCATCCTTCAGTGCAAACAGACAAAGGCACCCTCAAGCAGAGACTGTTACCT
CTTG