Description :
From Genome Similarity Track
Location :
Scaffold_6:306233- 308739
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02437Hypothetical protein

Sequence
2506 bases(100 bases per row)
ACGTCGCTGCACGTATGATCCAGCGGCTCTTCCGCAGCTACGCGGCCCGGTGTCGCCACATTGAGAACCGGTATCGCGTGCGCATGGCCATGACGCGCGT
CAAGGCCCTCCACGTGCTCTTCGACCGGACGCACTGGCAGCAGGTCGACTTGCACGCACTCAAGCGCGCCGAGCTCGAGGATCTGGCGCTCCGGCTCGAG
ATCCCGGGGCTCACGGGCAAGAAGGGCCAGATCATCCAGTCGATCCAACACTGGATCGACCTGCGCCTGCACGTACGCGACGTGGCGATTGAAGCTGCGA
CGCGCGCCAACGACAAGAGGCTGCAGGGTACCAAGTCTATTCTTTCTACCGATACATACAGCATGCTCCTAGCCCAAGGCGGCGTGTACGTGCTGGCCGC
GACACCCGAAAGCCGACCTACCATTCTACGACCGCTCAGTGGTCGCACCATATCGGCTGTAGCTGCGGTGCGGAAGACTTCTAGAGCCTCGCGCGTCTCC
TCTCACAATGACCGTCTAGAACTTCGAGTCGGAGGCCGTGTACGCCCTGGACACGACCAAGGGCCTCGTCTGGCTCTGCAAAACGTCGGGCTTGGCGGCC
CAAGTCGGACTCTGCAGCACCCTGCGCGACGACGACGTCTTCACCGACCCGTACGCAGCGCAGTGGCTCGTGACGCCTGTCCCGATGCAGACGCTTCGCA
TGGGCCACATCCAATCGCTCTGCGTCGGCCACACGCATGCGGCGGCGCTCGCGTCCACGGGCGAGATGTACACATGGGGCAACAATCCGTACGGCCAACT
CGGCCTCGACCACGCCGTGCGTGCGCGCCAGCCACCGTTCCTCGTCGGCGTCACCGAGACGTTCACGACCATCTCGATTGGCGTCGGCACGCAGCACTCG
CTCGCCGCGTGCGACAACGTCAAGGAGCAGAACGGCGTCGTCTATGCGTGGGGCGGCAATGCCCACGGGCAGCTGGGGCTGGGGCTGGGAGGTACACTTG
CTAATTCTCTTTTTCTGTGTCTTTTGAATAATGCCGGTAGCCAACGCGACGGTGTCGACGCCGCAGCGGGTCGTGGCGCTTGACGGCAAGAATGTGCGCA
AGGTCGCTTGCGGCGCCATGCACTCGCTCGTAGCGACCGACACGGGCGATATGTATGCGTGGGGCTGCAACGACGGAGGTCTCGGCCTCTTCCATCTTGG
ATAACCAGCAAACCACGCGAGTAGGCCGCCTTGGGCTTGGCACAAGCGACACCCGCGTCTCCGAACCGAGGCGCATCGAAGGCCTGTCGCCGCCGTTCCG
CTGTGCGATCGCGGTGGCGTGCAGTGCGTGGCACTCGGCTGCCATTTTGGCCGAGAGCCCAGGCGCAAGCGTTGGGACGGTACGACCTGGCTTCTTGATG
ATAAGATCTCTCACGTCGGTCACATAGGTGTTTACATGGGGCACGGGCGTGTACGGCCAAGTACGGCGACGTATTGCAAGCTCGTGGTGTCTCATGAGCA
TGTCTAGCTGGGGCTCGGCAGCAACCAAGTCGCGCAGAGCCCACAAATGGTGCCGCTGCCGCCAATGAAGGCGCCAAGCGATCCGCTCGAGAGCGTGCGA
ATGATTGCATGTGGCTTACAGCACATGGCCGCACTGACGGTGCAAGGCCACCTGTACACGTGGGGCAGCAAGGACGCCTTTAGCCCCCTCCCACACCTTC
TCTCTGCGAAGCACCGCTCCCCAGGCCGGATAACGTCGCGTGCGTCGATATTCGTCGCAGAACCCTCCCATGTGACTGATTTCTAGTGGCTTGCGGCGCA
TCGTTCACGATCTTTTGCACGCTACCCGTCGACGAGGTGCTGTACGAAGCTCCGACGCGCCACTTGCTGTGGCAGACCAAGCGCCTCCAAGTGCCCACGC
TCGACTTGAGTAGTATACCGACGGAGATGCGACTCACGTCTGCCGACAAGGTCGTACCGCGGTACGTGCGGCGACGGCTTGTTGTCGGCGGGCGTTTTGA
CGTGGAGAGTAGACTGCAACCCGAAGCCGAGCGGTACGAGAAAACTCAAGCCGCCCAGGAAGAAGACGATCGCATCGAAGCTGTCGATCTCGACGCATGG
CTACACCCGCGGTACGCCCATGATTGAACGACGCATCGATCGCATGGGCGGTGGCAGGTGCCGTCTGTGCTGGTTTTGCACGGGGTTCCAAATCACGCTG
ACAAAGCTCAAGCTCTGCCGGATCTGCAAACACAACCGCGAGTTTCACGGTATCTCTCGGGCGCAAAGGAGCGAAGCTCATTGGTCTAGGGCGTCGCGAG
GGTCCCATGACGCAGTACGAAGCCGTGCGCAAGGTCCAGAGCAAGTGGCGGCAGCGCCAGGGCACTCGGTTCCTCCATGCTCTCTTCCTCGAGCGCATCC
AGCGCGTCTTCTCGATCCGCCACAACGCCTTCTTCTACTACAACACGTGCAGCCGTGCCAAGACGTGGGTACGACCAACGTTGCTGCCCATCAGCATGGA
CTGCCC