Description :
From Genome Similarity Track
Location :
Scaffold_70:306174- 308017
Transcript NameFunction/comments
Physo_139136hypothetical protein

Sequence
1843 bases(100 bases per row)
GTTGTCGACGAACCAGCGGTTGACGCAGGGGATCCAGAGCTGGAGCTAGAAGACAGCAGGGTATCGTCATCCGTTGAGGAAGTCTCGGTAGACGGTGATT
CAGCACTAGCGCTCGAAGTAAGCGAAGTGTCAGCAGTCGAGGAGGCTTCAGTCGTCGATGAACCTGCGCTAGAGCTGTCAGTGGTCGATGATCCAGCGCT
GGAGGTTTCAGCAGTGGATGAACCAGTGCCGGAGCTCTGCGTAGTGGACGACCCAGTGCTTGAGCTGTCAGTAGTGGACGACCCAGAGCTGGAGCTTTGT
GTAGTCGACGAACCAGTGCTGGAGCTCTGAGTCGTCGACGCCCCGGTGCTGGAGCTCTGAGTAGCCGATGAACCGGAGCTGGTAGACGGTGTAAGGTCAG
ACGTCGAGCTCGACGTAGTCGACGCAGTCGTCTCCGTTGAGCCTGCCGTAGACGAAGCCAGCGAGGTCGCCTGCGTAGTCGAATCGGAGCCTGCCGTGCT
GTCCGTGAAGTTGCTACCAGTGCCGCCGTTCAGAATGTCGTTAATGTAGTCCATGACGAACGTAAGACGAGTGTACACGCCGGCGTGGACGCCGCACTTG
CCTCCCCAGCTGACGAACCCAATCAAAGTGTCGTCGCTGGTAACCAGAGGGCCGCCCGAGTCTCCGTTGCACGAATCCTTGCCGCCGCCGTTGCCGGCGC
ACATCATTCCCTCCGTGATTCGGTTGTCGTACTGCTTGTTACACTCAGCGTTCGAGATGACGGCAACGTTCACCTCCTGCAGGGTGGGGCTTTCCGAGCC
ATCCTCGGTCAGCCCCCATCCGAGCACCGTCACCTCCGTGCCGACCGCGTTGTCCGAGCCGTCCGCCGCGCAGAGCTTGGCCGTCTTCTGCTTCGAGGGC
TTCTCCAGCTTCAGCAGGCCAACGTCGTAGAGGTGCTTCTTCTGGTTGTACAGAGGGTGCTGGTAGCCTTCGATGACCTTGATCGCCTCACTCTTGCCGG
AACCGGAGCCCGTCCCCATCTCCGTCCCGAGGTGGGCGATGATAGTGTCTTCCTGGGTCTTGATGCAGTGGCCGGCAGTCAGAATGTACTGCGGGGCGAT
CAGCGTGCCGCCGCAGAAAGTCGTGTCCACCTGCTCGAAGCGCAGACTCGTGGCGTACGGGTAGTCGTCGATGTTGGCCTCCGAGCCGCCGTAGATGCGG
TTCTCCTCGTTGGCAGTGAGCCCCGTGCTCTCCATGTCATTGGTACTTGGGGTGGTTGTCTTCATGGACTCCGAGAACGAGTAGCCGTGGACCACCGATG
AGACTGCCGAGGCCAGCACAAGAATCTGCGGGACCTTCATGCTCACTCGGTACAGTGGGTCGGTGCACTCGGTATCACCAAGTGATTAATTAACACGTCG
CTTAGCAGGTCCGTCGAACAGCTCAAAGCTTAGACGGAGAAAGCCAAAGTGGCCGTCTCGCAAAGGCGCGACCAGGGGGGGAGACGATGGTTATGCTGGA
CGCTCTCCACCTCCACCACCATCTCAACGCGCTATCCGGTCTGGGCAGTCAGCTCGATTAGTACATGAAATACCCCGATCAACGGTGGCGCTAGACCCAT
AGAGCGATCGGATTCGAGGAAACGGCCGGATGGTGCCAGCAACTGTACTGAGATATGGAGCAGCAGGCCATTACTCCACCAACTGGCGCTGCCCAGCCCA
ATGCTACGAAAACAGCGGTTGCTTGCCGCGTGCGACTCGCATCAGGCTGCTCCCGGCCATGCGGGATGTGAAGCGATCATTTCGGCTCATGTTGGCGACA
GCTTCAACGCCTACACAAGACAACCGCAACGATACGTACAGAG