Description :
From Genome Similarity Track
Location :
scaffold_19:30614- 32831
Transcript NameFunction/comments
Plaha_PHALS_09584metalloprotease family
Plaha_PHALS_09585anamorsin isoform x1

Sequence
2217 bases(100 bases per row)
CACCTAGCGCCAATTTGTCGCATCGAACCTGTGAGGCAGCATCTTCACCTCCAAAGCTACTTCCGCTTGGCACGCCAATTATACCATCAGTCTGAGACGT
ATTTTGCCCAGAATGCTTGGGATAACGCGTATGTACAACCGCAGTGCGTAAAATATTTAAATGTTGGAACCGATGGTATGGCTCACTTCATCTTGCCGTT
TTGCCTCTTTTGTTCGATATTTTATTTGCAGCTACGTATTTCTGGCCAAATTTATCAAGTGAGTCTCAAGCGAGCTTGGAGCTTCTTGTCAGTATAGAGA
AGGCTGACTTGGTCCCACATGCTATTTTCCAAcatttttatttgttttttacAGAATCTGCTCGAAAGTAATCACTGCTCATCAGCACTATAATCTTCTC
TGTTATCGTAAGGAACGCGAATGGGTGCAAACGGTATGCTAAGATTTCCAAGTTTTGAGTGCCGTTATGGTCTAACAATTGGACTTAATGCTGCACGTAG
CAAGCTGAAGCCGGTTCTAGACTTTTTGATGCGATTTTAGATGGCATGGAGGCGGAAGAGCTCGAATATTTGGAGTATGAGAACTCACTTAAAATGAGGC
AAGACAGCGTGACCGACGTGGCCAATATGACGGGATTAGAAGAGAGACTGCGGGCGATAAGGCTTAGAAAGAGTGTCGAGCGGCCGAATGAGCAGACGGC
AAGAGTAGCAGAGAGAGATGACGTGCATGTTATTACTGAATCTACAAGAAATCGTTCTCGGGTGCATAAGGCTCTGAGGCCTCACCAGAAGGTAGAATCT
GAGAATTCACGGACAGATGCTTGAATTTTGATATGAGTTTTTTATTCAGAAACTCAGGCAAACGGTTTTGTATCCCGTTGTCGGTAAAGTCTCCAGTATG
ACAGCTAATACTGGTCAACAGTCTTACAAGTACTATTTGGCTCCACCATTCAGTCGTCAACGATCCCAAGAAGCTATTGCTAACTTAACTTGGTACGTCT
ATGGTTTTGATAGCAGACGCTTTTACAAATTTGGTACTTAACCTAATTTTTAGTGGAAAAATTCGCTCGCTTGACCTACCAGCAGGTGTTATTTCTCAAT
TCACGGTGCTAGCATCACCAAATACCAACCAGTCACCCTACGGGATTGAAACTTGCGGCATTTTAGCCGGTGTATTGGTAAGCACATCGTGTGAATCCAT
GCGAAAGCTTTCCCTGATTTTTGTCACTATTTACAAAGCATGGTCAAAAGCTGATTGTTACAACTCTCATCATTCCAAAACAAGAGGTAGTAAAGTTCTT
AGTCGTTCTGCTTCTACATTACTTACCAAGTGTATTTTCAAAGGGAACATCAGATATGTGTAATATGACAAACGAAGAAGAGCTGTTTGACTTTTGCTAC
AACAATGAGCTGCTCACTCTTGGCTGGATTCATGTAAGATTTTTGATTGAATGACATCACTAGTCAGTTGATGATTGTTGGATTTTTAATCGATATAGAC
GCATCCCAAGCAGGCTTGTTTTCTGTCATCTGTCGATGTTCACACCCAGTGTGGATTTCAGTCGATTTTACCTGAGGTAGATGCATTTGGCTCGCCTATT
AGATTCTGAGTTAAAAACTAATTGATGTCGACTCTCCTTAAGGCTGTCGCAATTGTCGTTGCCCCAAGCGATCCAAATAGAAAGTACGTACCGGACACGC
TGCTCAATGATTATTTTTATGGGTCCACAGCCAACACGATTTCTCTGATTTACAAGTGTCGGAGTGTTTAGGTTGACAGAGCCCAGCGGACTCCAGCTCA
TTCAAAATTGCAACATGACGGGTTTTCACGCTCATCCTAGTGATATTAAAATCTACTCAGACGCATTTGAATGCAATTGGATGGAACAAGTCTCGGCGCA
ATTAGTTGATATGCGGTAAGGCGAGGCTGATTTCATGGTCATGTCGTCGATCTAGTTCGGGTTTTAAAGtgaaatatagcaagccgaaTTTGTAAAATGT
ACTGCCATTAACTTAGGCTATTGATGCACCAACAAATGTATAACTTCGCAGACTGCTCAAGCAATATCGGTCCGTAAAGCATTTACGTTAATGGAGTTAG
ATATCATCGGAGTTGTCCAAATTAAGCAGAACCTTTTCCATGCCAGGTTTGAAAGCAGGTTTGCCCAAAAATGGACAGCTACCGCAGCGAAATGCGTCTC
CTTTGTAGCACTACACA