Description :
From Genome Similarity Track
Location :
Scaffold_481:3061- 7845
Sequence
4784 bases(100 bases per row)
AAGAGAACATCGTCGATTATGGTAGCGACACTGTCGCACCAGGGGGTGAAGACCCTGATCCAAACATATCAGCGTCGCGCGGCCCCCTACCGGTATACGA
ATTGCTGTGTAACCCGTTCACAGCGTGTACTGTAGAATAATTTTATCCAAACATATCAGCGTCGCGCGGCCCCTCTCTCATAGCGCCGAATCCGTTTACT
GAATGAATTATATCTCAAGCACTAACAGCGGCTGCGTGCTTTAACTACTCTTGATGGATGCATCATCACGAACAAGCTCGATGAGCAACAACAGCAGTTC
ATCCATGAGAATGAGAGATTTAGTCGTCTATCTCAGATATTAGCTATTACCGAGGCACATGCTGACTATCGCTTCAAGCCTTTAGTAGAAGCCTCTCCAC
ATGGAGCTGCAAGTTTCCTTGCTCGTCGAGCAACGTAGGAGGGACTAGGTGTGTCGGTACAGGATCATGAAGACTTGGTGTCAGAGGTAATACGACTCAG
CGAGTCTTTTGCTCACATGAAGACTGCACTAGATCGGTCTGTTGCTGAGAGAAGACAAATTCTGCAGTTTCTCGATCCAGTGCATCGCGCTCGTGAAACG
TCATCGACTGATACAGCATAGTTGCGTGAGAAGATGAATCGCTTCGGCTTGATTGACTCAGTCAACAAAGGACTGCGGAAGGTGGATCACAACCTGCCTC
GGCTGGATGGCCAGGTCGATCTCTTGACGGGAGATACAATTATCGGGGACGACTTCCCTCCTTCTGGCGCAAGTCCTTCCGTTTCGAGAGACAAGGATCA
CGATATGGCTTGAGTAAGACCACGAAAAACAATGGGTGTGCGCGCAGCTTGCGCGGAAGATTAAGGGTATAGGCAAGTCCTTTCTTCCCTGTGACCGTGA
ACTGCCCGGTCAAGCGTGGGCGCAACTTTGTCTTGAAGACGGCAGACACCACATTTGTAGGTATGGTTTTAGCGTTTAGTAAGACATAGTCTCCAACTTC
ATAAGAATCATCTGCCTTTAGCATCAGCTTTTTCTTTTAGTTTCTCTTGGATATCATCCATTACATCACTCACATATCGTAAGACACTACGGAGCGTCGC
TAGAAATTCCTTCACTTGTTTATGCATCATGGTAGGGCTAATATCAGCAAGCTTGTCAGCATACTCTCTCCCACCAAGCCCAGAACCACGAAGTGGTAAT
GTGATCAGAACGCGGGGGTGCGTGAGGCTATATAGAGAAGGGAGCGAATCCGGTTGAGGCATGAACAGCGTTGTTCAACGCGAACTCAATTACAGGAAGC
ATCGAGCTCCAAGTCTTAGGCAACTTAGAACAAACACTGCGAAGAACGTCGCCGATGACGCGATTAATTATCTCAGTCTGACCATCGGTCTGCGGATGAT
CCGCTGTGGACATGTCCAATCGCGTTCCAAGCACCTTGAAGATGGAAGCCAAATTTGCCGGTGAAGCGAGGGTCGCGATCAGAGATGATTGCCAGCGTCG
ACCCGTGTTGACCAAACACACAATCGATAAACAGCATAGCTGTACCTTTACCATCGATGGAGTCCGACACCGCCGCCAAGTGAGACATCTTGCTTAAACG
GTCAGCAAAGACCACAATTCCCGTATTACCATCACAGTCTTTGGGAAGGCCAAACATAAAATCCATACCGATGGGCTCTCAACATCCCTTGGGCACAGGT
AAACTGGAGAGTGGCGCAGCGAATGTGCTGAGGGTTTGACCCGCCGCCGTTTCGCATGTACGAACGTACGTGCTCACCCATTGGTAGAGTTTGGGCCACC
CGTAGTGTTGAATCACAGAGCCATAGGTCCTTTCCCGGCCCAAATGCCCACTGAGGGCAGTATCGTGGGCCTCCAAAGAGGATTCGATATTTTAGATCCT
CATTTTGAGACACAACAATGCGATGGTATCCGCTACATATGTGCGATAGCACAAGAGGCCATTATCGATGGAATATTGATGTAGGCTGGCCCGCAAGCGT
GCCGATAAATGACTGTCCGAGTCCTTGTATTCCTCACTCCCTATGACATTAGACAATGCCACACACTGAGGGTCGCGTGGATATGCCACACGAATTAACT
GCTCAATAGGAGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCGGCGAGAGAGGGCATCGGCCAACACATTTTGTTTGCCTGGCTTATACTT
CACCTCGAAGTTATATTCCGCAAAGAAGGAAATCCACCGAGCCATTCTCTGAGAGAGGCAACGAGACTGTGTCGCCAAGCGTAGTGACGCACGATCCTTG
TAGACGACGAATGGCTTGGAACCAAGCAGATGGACTCTAAATTGGACAAGCCCGTACTTCATAGCAAGAAGCTCTTTGTCATGAACTGGATCGTTCTTTT
TAGAAGCTTTCAGTTGACAAGATTCAAATGAGATAATGCGCTCGCGGCCTGCAGCATCTGTTTGCAACAGGGCGCTGCCTATGGCACAGTCGGATGCATC
GCAGACGAAAATAAAATGGTACTCAGGATTTGGCAACGCCAAAATGGGAGCATGAAGGAGACTCTCCTTTATTGCCCGAAATGCGTCAACATGGGTGTTG
TCCCAGCGCCAAACTGTGTCCTTTTAAGGAGATCAATTAATGACCGAGATATATCAGCATAATTTTGACTGTATTTGTCGAAGCAATTGACAAGGCCAAG
TTACTAACGCAAGTCCTTTTGATTTTTAAAATCGGCCAGTCCACTATAGCCTTGACCTTATTGTGATCCGCTCTGAGGCCTTCCTTACCGATCAAACATC
TTAGAAAAGGAACCTCTTCTGCACTCTAAATGCATTTGGTCGCGTTGGCAAAAAACTTATATGTGCGCATAGACTCGAGACCGGCTCGCAAATGACCGAT
GTGATTGTCAACATCTGACCGACCTTGTTCGGCACGACTATAGACAAAAATGTCAGTGCGTAATCCCGATGTGGGCGGAAAAGTTTCATCATTTTAAACG
CAGCCGGAGCATTAGACAGCCCTTTGACATCACCAGCCATGCCCATAGCATACCACTCGGAGTTCTCCCTGCCGAAAGCGGGATATCACTCGCTCTCGTA
AGAAATTGGTAATATCCATCGACCAAGTCGTGTGCGCTATACATAGTACAACCAACCATGTTGTTTTTGATAACATCCTTTCGAGGAATAAGTGTCTGTG
CTGGAATAGTGGCCGCATTGAGCTTGTTCTAAGCATTTACAATACGCCACTTGTCGTTCGGCTTTTTGACACGAAATGTCGATGTCGAATGTAAGGATTT
ACTCTCACGTACCATTCCTGCTTCGTGCTTGGCACGGAAGAAGTCGTCAATGACATCACATTGTTCCTTAGGGAAGGGCTACTGTCGTGTGACACAGTAT
TAGATTCCAGGACCCAAGTTAATATCATGACGGACACCTCTATCTGGAGGTAAAGCAGAGGGTGGGTCGTGACACACCACATCTTGAGATTCCTTGACCA
AAGGATAAAGCATCACGAGGATGTTCAACATTGATGACCCACTACGCTCACGAGTGCCGCTTTTGTGTTATCTAGAACGGCTTCATCCAGAAGCGAAGAA
GAGTTCAACTCTATGATGTCTGGTCGAATGATCACCACCTCTGGAAGGTCTCCATTCTTTAGTGAGTGAATAAACCCATCGACTAAAAACTCTTCAAGTT
CTAGAAGAGTGCCTAAAAAGGGTATAGCCTCAAGGATAGACGTACCATCATAGACACCAGTCACTCCGTTGACGATTGTATACAGCTGATAATCATCATA
TTTTCGTGACACAGCTCGCGCTTTGTGACTTGTATCTTTATAATCGAAGTCATCGTCAAACTTATTTTGCTCTAAGATAGAGCTGATTTCGCTATCGAAA
TCTGATGACAAGTCATTTGACATGACGTCATCATCACGTGGATTACGTGCACTTCACGCACATCCGCTGATCCGGGCTCGGGATGCCTTGGTATTTCACC
AACAACGACAATATTGACATTTAGCGCGTCGCTACCACATCCAACGTCACTCATTAGGTACCACTACACGCTCATCTGATGGGTCCAAACCTCGATGACT
TGACGCTTGGTCAACAATGCTTTGATCATTCAGTGTTTCGTTCTCACAACTACTACTACTCAACAGAGTACGTGCCGTTTCACTATCACATAACGAGCTT
TGCTCCATACTCATGTCTTTGACATTATCAGAATCAACTGATTCCGAAATTATGAAGTCCAACACACTGACATTTTCAGCCAGGGGCTCGCGCCAATAGA
GCTTCTTATTCCTAGCAGAGATGCGTTCATGACTTTACAAAGCTCCGCTAGTGGCAGTGCGCGTTGCGCCTAATGTTATTGACACCCAGTCGATCCATGG
ATCGTGGGGATCAAGCCAGGCCATACCAAGAATGAGATCATATCTCGAGTCTAAATCAATAGTTCTTCAATTTTGATAGTATCAAAATTGAAGAACTTCA
CACCCAAGTTCACTGACACTTTGGGTACGGTGACTTGAGTCCCTGTAGCTAAGCGAACAGTGATAGCATTACCATTATGCGCTTGTAGCGCCTCAGCATA
ACGTTCATTACCTTTAAGGAAACATCGTCTTACCGGATGCACCAGAGTCGATCAGAATCGACCAGGGTTTCTCCAAAGCCCTTAACAGTCGACCAACATG
CCTGAATTGTATCCTCGCCCCGTATTAGAGTGTACGGAGCTCCTTAAGGGTAAGCTCTGTTCGCCACTACCTCCAAGAGGATCA