Description :
From Genome Similarity Track
Location :
Scaffold_65:30609- 33624
Transcript NameFunction/comments
Phypl_g2234hypothetical protein

Sequence
3015 bases(100 bases per row)
gcagcagcatcgcgcgcctgctgctACTGGGCGTGGCCTTCCACGCGCTATGCGTccgcagcatcttcgacATCTACTTCCAGTCGTCCGTGGAGACCTC
CATCCTCAGCGCCAACTACACCTCGTCGCCTCCAGCCAAGCGCGTCATCATCTTCACGTTCGACGGCTGTCGCGTCGACAAGCTCTTCAAAGCCGTCGCC
GGCTACGCAGACCGCTACGACCTCAACCCGGACAGCGTTGCAGTAACCTCCCAGTTCACCTCCGACAGTCGCGTGCCTTTCCTGGGCGACGTGATGCGGA
ATCGAGGCAGTTGGGGGGTCTCGCACAACCACGCGCCGACCGAGAGTCGCCCATGCCACGTGGCGCTGACCGCCGGGATGTACGAGGACCCGCACGccgt
ctccacgagctggaagcaACACCCGGTGCCCTTCGACTCGGTGTTCAACCAGAGCCACAACGCCTTCATCTTTGGCAATAAAGACGTCGCGCCGATACTC
GCGGCTCACGCACCACAAGCTGTGGAAGAGCACTACACGGCAAACGAGGAGGTTGCCATGGTACGGGAAaacacgacgctgctggatgtgTGGGCGTATC
GCAGGGTGAAGGAGCTGTTTGCCAGAGGGACGGAAGCGAGGGATCCGGAGCTGTACAGGAAGTTGCGTGACGACAAATTGGTGATCTATTGCCATTTTCT
GGGCACTGACTTGACAGGACCCAAGTTTGGAGCAGATTCGAGAGAGTACTTGGAGAACATTGCAGTGGTGGATGGATTGATCGAGAAGACGCAGCGGATG
ATTGAGGAGTATTATGGAAACGATGGACGCACAGCGTATGTGGTCAACGCGGACCATGGAATGGATCTTCGTGGTGACCATGGTGACGACGCTCCGGCTA
AAACGCGGACAGCGATTATTGCGTGGGGTGCTGGTGTCCAAGGCCCTGAGGCGGCGAAAAAAACTGACACGGAAGAGTTTGATATTGAGTTGCCTACGCG
ATCTAGAGCCGAGGTTCAGACACGGCTGAAGCCCCAGGAACACGAAGAGCAAGTGGCCGCTCGTGAATGGGGAGCAGTGCTGGGTTTCAAGCGCAAGGAC
GTTATGCAGACAGATGTGGCAGCACTTGTCAGTGCCTTGGCAGGTCTTCCGTACCCCCGCAACTCGGTAGGAGTTCTACCGTTTACTTACTTGATGAAGG
ACAAGTATCGCGCAAATGCCATGCGCGCAAATGCACAGCAACTGTACCAGCACGCGTcgcgcaaggaggaggcaAAGCGCGCTCACCGGGGTTTGCTTTT
TGTTCCGTACTCACCTCTTCACTACCAAGTACCAGACCTCGAGGCCCATATTGACGAGGCCATCGATAGCATCAGTGAAGGTAAAAGTCGCACAATTCAT
GACGGTGCGCACCGCGTTGTGGAAGTATTGAGCCAGGAGATGATTGATATTTGCCAGGATGCGATCGTGTATTACCAGACGTACGACTGGTTGTATTTAC
GGGGATCAGTCGTGCTTGGTTGCGTTGGCTGGGCTCTAGTCATGACTGTTGCCTATCTACATCCCCAGAAATTTCGCTCACGGTGGCTCTTGACCCATAC
GATTGACATCAAGTTTCTTGCTACCGTGGCTGCAGTGGTGTGGTGGCGGCTTCTTGCGGATTCGCCGCCTATGTATTATCTGTACGGGTTGTGCCCTCTA
GTGTTTTGGAAATTTGTTTGGAGACATCGTGGTCAACTCCTAGCAGTACTTCCTCATGGGAAGGGCTCCGGTTGGAAATGGAGTGTTCATGTTGCGTCGA
CTCTCCTTTGCTTGGAGCTGGTCGTTTTCGGTTTCCAACGTCGTGCTGTATTCAGTTTTCTTTTTGTTCTACTGGCATTCCAACCGCGGATCATCAATTG
TAAACGACTCGAATCGAGGGGGAGCGTGCAGTTGAAAAACCGCCTACACTGGAGAAAGTTTCTGACGTCAAGTTTTTACTGGTCTACAAGCTGTCTTTTC
ATTGCTATTTTTCCGTGCCTGCCGACCGATTACGACGATAACACACCCTTGGTTCATCTTGGCGCGTTGTTGGTATTGGCCTTCACCTCAATTGTGATTC
GCAACATATCGGCTACTCACGATCGAGCATCCCAGTGGAAAGTGGTGCTTGCATCTAGAGGACCTTCGGTGCTTCTGGCTATGCTGACTCTGCACTGGAC
GACAGCTTATCTAAACAGCAAAAGCACACCGCCATTTTTCCTTGTGGCACTCAACTGGATGCTCGCCATCGTGCCACCGATATGGTTGCTCGTTCAAATA
ACATGCCAGAGCAAAACGACCGGGTTGCGCTTGTTCAAACTTGAGAAGGGTGGCGACTTGGAAGGCCAGCAAAGCTGTGGAGAAGTTACGCGCGTGGTGG
TTGTGCGACTAATGAAGGTGGCCTTAGCGTTTGCACCGGCCTTTATATTGCTTAGCACGTCCTACGAGGTGCTATTCTACGTAGGGCTATGCAGTGCGAT
TGCTTGTTGGGTGATGCTGGAAGCAAAGCAGACTTTTACAGGAGAAGTTTCAGTATCTAGTGAGGTTCAGCGAGCGTTGACGTTTTTATTGTTTGCCCAA
GTTTCGTTCTGCGCTaccagcagcgtggccagccTGACAAGCTTTCAGATTCCATCAACTCAGCGGTTCCTACCAGAACCCGCTCCCTCCATTGCTCAGG
CGCTTGTCGTGCTGAAGCTCCTGATTCCATTCGCAGTTGTTGCGTGCGCTTTCCGCCTTATCCTACTGCTACCGTCGGGAGCTGTCTCGACACGTGAAAA
AGAGCTGCGCGGAAAGTCTTTATGGGTATCGAGATATTTTCTTCTAGCAGCGTCTTTGGCGGAGATCCTCGCTGTGCAGTTCCTCTTTCTGGTGAAGAAT
GAAGGCAGTTGGAAGCAGATGGGAAACTCCATCGCGGAGTTCTGTATCGTCAATGGCCAGATCGTGCTTTTACCCGCCATTGTTTTGTTTGCCTGGGCTT
TTGTTCACGACCTCG