Description :
From Genome Similarity Track
Location :
Scaffold_30:30608- 36872
Transcript NameFunction/comments
Phyca_LT1534507736phosphatidylinositol-4-phosphate 5-kinase, partial
Phyca_LT15348633coatomer subunit zeta1 putative
Phyca_LT1534507739Hypothetical protein

Sequence
6264 bases(100 bases per row)
gatggagacatgccggatggacgacgctccatgcggcaattgccccctgtggaccagaatggctccttccgacagcgcaacggtgtcacgcgtggcgcgt
cgggtggatttgttactatggataacagcagcacgataagtagctccagtggaaactacatcgacgccatgagtctccacaacaacaacatgagtgctac
agcgcagcaacctttgatttctaccccgcgtgccacacagaagaacattgttcgagtgatcgacaaggacatgacgcaacaattccgtggtcgctctaaa
tccgtgggccagggacgtatccgctggttcgagaatcggaagtcacagctcctcggtttctgtcttacaatggcgttcctaggcgtatctgttgctatgt
acaactaccgctggacgggacttattgcaggttcggtgaacaccatcatctgtggatccgctgttgtggtcacttactgccgcaagaaacaatggcacca
gcacccaaatccgatcgtgcacaaccgttcggtgctcagtattttcatggccatttgcttgctgttgaacgttctcgtggactttgaccctagtggatcc
aacaccgactgtcagcggctcgcaggtattacggaattctttttctttacaggcgaagcgtggggtctcgttatggcttgtgatcttttcttttccctga
cgagtccgttcacgagctacaaacggttgatgaagttttatcacttgtgggtgtggcttggaggtatcatcatgggtgtgatcacgtactctgtgcaggg
tgctggtggtttcttcacggtggatggccaatcgatgacttatgaatcagacaccgacacagttgtgggtttctgcctagcgtcatcgagaatttgctgt
gattctggagaaacttgccctgataccgtacagaaatgctcgacaactgcgaacttcatgaacgcacagaaatggccgtggattttgatttacgctttcg
tgcttctggtgttatttgtgtctgtctggtacgtcttttaatgtgaaaggctctgtgtgttaacgacgactaacagctctcatttgaattcagtgtccta
acgttggcttggcaccgactttacctgcgcggcgtcccaaagacttacaacatccgtcttcgtgtgctgaactacatttccttgtaagtaaattttcctt
gggatgcttttattccgatttgattctaacggtcaacgtttagcttcaccggtgcctacgtgttctactggctgctcttgttgctgctgtacatgtgcgc
gtatttcttgtctacaaagagcgacacctcgaactcgaaggcagttgcccaagtgctgcgtcagctggtcattttccttatttcctcgaagggctatctg
gactatgtgatttggttcgcagtgaacaatatcgagagaaagagtggaagcggaaacgatgaatcagcaaatgtggatgtcgatctgagtccccaggtga
acacagccctgcgctcagagattttgtactacacgacgtccggcattaaggagtctgtacgtgcggtgactgacgagttgatctccattccgatctctgg
tgaaagtgaagcgggcaagtccattaagttctggtcgttctgtcctgcttcattccgaaacatccgcctcacgtttgggattagtgatgccgactacatc
caaatgttcggtgccactaccaaggaacgattcagcgaaggccgcagtggtgctttcatgttctacacgtcagatgagagtctgattgtcaagacaatgt
cacccgaagagtgtgcgttcctgcgtaaaatagcacccaactacgaggcctatatgaccagcaatcctgacactcttttgacgcggttctacggctgcca
ctccgtctcgttgtatggaaaaatgtactatttcgttgtcatgggcaacctgttcgcagacacggatgttgtccaccaccgttatgacatcaagggatca
tgggtggaccggaatgccaaggttccaagccctggcgacaagactgcgtgccgttactgtaatgcttcatatacgtttggcagcacgaagaaccaggaat
gtggcgacggtatgaacttccacgagcccgatatcgtcctcaaggataacgacttgatgacgaagattcgaatcgatccagccactgcacaccgcatcta
cgaccagattcacaaggacagcgattcctatgctcgcaaggcatcatggattatagtctactcatgggcattcaaagctccgagtactttgtcgacacga
gccagctgccacatggtcgtcgtgacttgcttttacacagcctgcgacgagtgtggctggtccgtcgctttaccatttcggtattattgacttcctccag
caatggtacgtcgaagtcatcgatgctatttgtttttcagtttggtaacatcttttactgtttttataggacaatggagaagaaaatggagcgattctac
aagactttcgtcaagcgtaaagaccccgaaggtgtttccgcgctgcccccgaagccttacaagttccgtttccagcagaagatgtcgcgtattttcgcgc
tgtcgacgcacacgcgcgccgagaatgacacggcgttcaaccacaattacccggctctgattgatgtgctggaccagggcaactttgacaaccagcgcca
caacacgtttgttagcaactcggtggtggaccagcgaccagttttcaacccggatctgcagcaggacattcgcgcggtgtaggtggaagtccaccccaat
gcgtaatgagttaagcaaaggtctctagcagctgcgaggtaagcatattggatggagacccacttttgataagtaggagagaaagagaagatcattttat
aagttttggttcattttttggttttgcagtaggaattgcgttaattttagccaatcaggatgacccacatatcctctgcaactccccctcacaacaaaag
tacgaagctaaacagcatggtcaaggtgcgtattactttctctctgtttgtgcgccattggagcagtatcccgcttcaagctgttgtctagatgtagtag
atatcgtggttattagaactgaccgtctggcttctttattgaacgcacggaaggcgtcttctccgagtgtgaaagcgatctttatcctggacagcgatgg
caatcgtgtgtgcgccaagtactacgacaagtcgtacccgacgcagaaggagcaacttgcactggagaagaagctctacgccaagactaagaactcgaac
gctcgtctggaaggtgtggcaattacagttgcagttgtgatactacttgaacagtagtctgacagtgctattttgtgtcctagccgacgttatcctcatt
gagaacatcgtgagcgtgtatcgatgtggatcggacacgacaatgcacgtgattggatcggcttcggaggtgagtggggaatctgtgagggtgaaggaat
gcggactaattgatgaatatgtgtgaatgtggtagaacgagctcatcttgttgtcagttttggactcagcgttcgacgctgttagcaacttgctcaagta
cgtaattgatgttgctgacgttttgactgttgatctgactgggttggcgctgcttgtaggggacggatggaccgccatgtgatgcttgacaacatcgagt
tggtgctgctcacgttcgacgaagttgtcgatggcgggtaggatttttgttgtgtgcggtgttttttcagatgtctaagttggtttctttttgtttaaca
gaattatcttggaggtcgacacgccgtcgatctcgaaccgtgtgctcatgcgcgtatggactttcgttttatctggcagcttcgactgtattggcactaa
cgtttaatgttacaattgctcagggtatcgacaacgaagttcccatggccgaactcaccatttcacaggtcggttctggatttgagcggaatatttatcc
aaaacagcttcctgacggcgttttaacttgtaggctttcgcttcagctcgcgagcaattctcccgttccttccgcagctaggcatgccacattaattgtg
tctaacacgattcatttgtgttttttcttccaataacatgtaaaaatcccattccatgggatttttaaagtctttaacccaatgattctaattggttaaa
aagaaagaaaaaaactaaatcgaagcgaagcttgtcatttcctactcgggaaggtgaagggtgaagcttggtgaagggtgaagcttgtggacgttgctta
tccatgacggacacgaagaacaaggagaacctgcaggtgcaggtgcaggcggagccctgggggcgcttcgtctttgtgtctaaggatccggcagaggaca
gcgaccacatttacttcggaacggaaagaccacgatcggccgcaataaacggcgctgtgatactgtgatcaacgagctctttatcagcagtgtggtacga
cattatctacatcttagctttttaattaatatctaacgggatcagttttttttgtctgttggcagcattgtgtggtggagttggaaggagccgacggccc
tggtcgaccgaatgtcaagctctctgacaacaggttcgcaacgctatctgtcttagtgggtaattatgcagagagctaacgacagcattcacgtgtattc
agccgcaatgggatctgggtcaatgcggatcgtgttggtaaaggaaactcggtacggttggacaacggatatactatccacttcactaaacctggtacaa
caccggcaggtacagatcggtaaaagttctgtttactttttgtgttgctgtactcactttttgctgtcaggaaccactccgatggcatacaagtttgagt
tcttgaagtacgttcgggagttgagtttaaccggcgttgtgatacatgcatgctgatctgtgatgacttgtgtgtatttcttcagtacttcccatggccg
tacggaccccaattcaccgtcaccaaagagcgaggcacacacagtaccagaagacgctaatatgacggttgttgctgatgagccgtttgagtctacacag
gtggctgtggttggggatctgtcgtctccatcggagaagaagcggaaaagagaagatgaagagcctgcagtcgttactgtggctacacaagaactcgagc
gtaaactgaaggctacgcactcccaactcaaggagacagaaagcaaactcgaggctgctgaaagtaagataactactctgaacgaagagctggagaaaaa
agttggcagacttgcgaaagaaaacttgaacttgatgtcgaaactggagatagctatggcggagattacgcagttgaagaccgctttgtccgcaaaagac
aaagacatggaagcagcaacgaaggcaagcttgaacgccgcttcaaaagaaaatcagaagttgaaggaagaacttgctgcgaaggataaatctatggcgc
tgaagattaaggaggctgtcaaaaacagtttggaggagaagaaggaggaagacgccaaagaattggtgtccaagctcaaggaggcgaccaagaagtacca
gcagaaggttgaagcagagaattttgagcagcgtcgcgaaatgagtgagaagatggctgcatttgcaaatgagaacgaaaagctacaaactacgcttgga
acgaaggaagaggagcttgcagaaactgaagataaagttacacgattgagagcaaaggtcgtaactctagaggagaaagttggcacattggctgagaagg
acaaagctatatccgatcatgaacaaaagatcggtgagttggaggaaaaggtcagtattttggctgcgaaggagaagaagctggcagagtgcgaagacac
aatcggcgagttggagaagaagatcaacgcatcgaaagacgagaatgcggagattcttggactccttgctgcagcggaaggaaaggtggttattgctgaa
aacaaggctgctgaagcttctatagtcgctgtggcagctgcaaaggccagcaagagcgctaatacgagcgagatacacgaactacaggaagccattacat
ccctgcgtagcgagctcgagacgtatcgtgctcagcttgccagccgcgaagaagaggtgcgtgaagatttgtttttgaagaagaatgtctcgactaacct
ttgctatctatgtgtcgttaaaatctttagctcaagaagcagcaggaggccgcagtgacagcca