Description :
From Genome Similarity Track
Location :
Scaffold_173:3060- 4370
Transcript NameFunction/comments
Physo_144212hypothetical protein
Physo_144213hypothetical protein

Sequence
1310 bases(100 bases per row)
AACGAGGTCCAGGAAACTTTCGCTGAAGGGTTTGAGCGTGGCCGGGAGATGGCCGGCATGGCAAAGGAGAAGACCGAAGAAAAGGCTGGCATGGCGAAGG
AGAAGGCCGGGGAGGTGAAGGACATGACTGCTGAGAAGGCCGACCAGACCAAGGAGATGGCAAAGGAGAAGTCCGGCATGGCAAAGGAAAAAGCTGGTGA
GATGAAGGATACGGCAGCGGAGAAGGCTGGTCAAGCGAAGGAGATGACCAAGGACAAGGCTGGTGTGGCCAAGGAGAAGGCAGGTGAGGCCACCGAGATG
ACGAAGGCGAAGGCTGGCGAGGCCAAGGACAAGACCGCCGAAACTGCGGGCCAAGCGAAAGATATGGCGAAGGATAAAGCTGGTCAAGCCAAGGAGAAGG
CTGGTGAAGCTGCAGGCAAGGCAGGTGAAACGAAGGAGCAGTCGAAAGGGGTTGTCGGCCAAGCTGTGGACAAGGCTGGCGAGGTGAAGGACGAGGCGAA
GGAGCAGCTCGGGTCCGCTGCAGACTCTGCGAAAGGGGCGGGCACCCGAGTGGAAGCGAAGATGACCAAGCCCAAGGAGCCGACTACGACCCAGGAGCAG
ACCAACACGGAAAAGGCTCTGGAGGCCGCGAAGCAGACGTGCGCGAAGGAATCGGAGGCTGCGAAGACTGCTGCAGGCACGGCCCACAAGGAGATAAAGG
GCAAGCACGCGGGTTCCAAGTGAAGGGAGGCCGAAGATGACGATCACGCGCGGGTGAGTGGAGTTCCGGCTCAGTCGGTCGGGTCGATCACCTTCATCAC
GATGCATATCTAAGTTCCATTTAATGAATTGAGCTGAGACGGCAAACTCTCGCTGCTTTGGTTGACATTTGTGTACTTTATTGCGCATATGCACCGTGCC
TTTTAGCGCACAACAAACAGCAACGCTACATGTTTAGTTGGAAAGCCTCTAGAAGTCGAAGGGGTTGAACGACTTGTGGGCTGCAGACTGCTGAGGTTGC
TGAGGCTGGGCTGGAGAGGCAGGCTGGAGGCTATCGAAAGGGTTTGATGGAGACGAGATAGAAGCCTGGGCATCAGAAGCTCGTTAGTGAGTGCCCCACC
ATGCAGGTGACAGCTCAAACGCTACAAACCTTTGTTGAGAAGTCCAGCATGTCGAAGGGGTCGTTCGAGCTACTCGCACCTAGAGTGCTACTGGTCGTGC
TCGGAACAGCCGGCTGAGATGACACGGACGTAGTGGACATTGTGAAAGCGTTCTCACCTGCAAGCAACAAGAGTTAGAACCTCTGATGGCCGCATTTATT
GACAAGCGAA