Description :
From Genome Similarity Track
Location :
Scaffold_1195:306- 2520
Sequence
2214 bases(100 bases per row)
GGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACA
TCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATA
CTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGCGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTC
GCGCGTAAGCGCCCAGACAATTCCTTGTCAAAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTC
CGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCC
CGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGAC
GCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTG
GATACTGGAAACTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGA
TTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAA
GGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCGCTGTACTTGTGC
AAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCGTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGGCTTTGGCAGGATCTGCCCGTAAGC
CACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGACATACAACTTATTAGTGCGCATGCACTCGAG
CACCGCTCGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACGAATGTATCGTCAAAGTACGTTTAAGCGTACGCC
CGGTGGGGCCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCAACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCG
GAGTACTCACCGCTGTCAGCGGAATATCGTTCGCTCTCATGAGCAATTGGTAGTGACGATCGACCAAGTCGAGTGCGCTGTACAACGTACAGCCTACCAT
GTTGTTCTGCAGAACATCCTTGCGAGACTTCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTC
GGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCAC
ACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGT
CGGTGGGTCTTTTGAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGC
GCCTTCTTGGTGTCCTCTAGGACCGCGTCGTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAAGACCACCTCGGCTAGCTCGCCTGCCT
TTAAGGCTTCGCCGAACTCGGCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTATCAAGGCTGATATCGCCTTCTACCTCCCC
CGTCACTCCGTTCACGAGTGTATACAGCTGTTCACAGCAATCACGTGGAGCATTACCGCTCGTCACGTTGGACACATCGTCCGACGTCGAAGACGTCACA
GACGCCCTGCGTCT