Description :
From Genome Similarity Track
Location :
Scaffold_131:306- 1803
Transcript NameFunction/comments
Aphin_H310_12826AlNc14C93G5771

Sequence
1497 bases(100 bases per row)
TGCTACCTCTTGGAGCGCGTATTGCATCCGAATCTGCCTCCAGCATCGCAAAACTCGCTCTTCCTCGCGTCGTCGGCCAAATACGTGTTTGACGCGGCGC
GATGGATCGACCACAACGTGCGTCGCCATGTCTATGATGCAGGAGGGAGCGGACTGACCATGTCCATGCTGCTGTACAGGTCTACTACATCGACCCGTCG
TCCGCTGTGATCAACGGGATCCTGTCGTACCGGTCAAACAACACGTTCTACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGCAGCCTCCGCAATTTGTTGGCCGGGCATGGAAGATCAAGTTTG
CAAACTTCAGAAGGCGATTTACGGACTCAAGCAAGCTCCAAGGTGCTGGTACCTCACTTTGCACCAGTGAGATCGGCTTCGAGCGGTGTGTCAAGGAAGT
CTGCCTTTACGTCAAAAGAGTCGAAGACTCGATGGTGCTTTTGACAGTATACGTCGACGACATCACCCCGATGGATCCGAACCGATGGAGACAAGTGCCC
ATTGACCAGGATTCGTGTCCGTCGTCCAGAGTAGAGTACCCCCACGATGTCAACAAAGGTTTCGACTTTCCAATTTGCCTCGTACCGCTCAAGTCAAGAA
AGCTCTTAGTGCCGCCAAGTTCCGTGAGGCGGGTGGACATGCGGTTGCCGACGATGACATCGCTCGGTGTGAAGCAGTGGCGGATGCTTTCTACAAGAAC
CCTGAAGACATGGACGCATTCATCGAAGACATTCTATTGATGCCCCATTCTCAAGTTTACGAGCTGACAGTGCGCTTGGGTGAAGGCTACCGAGACTGGA
AAGAGAAGACTCTGTGCAGTCAATTCGTCAAGGAAAACCCGGGGTCGCTGTGGGGATTCTAGTCGCACCGAATCTGCCACCGAAGACACGCTTCACCTAT
GTCATTGACAAATTCATCGCGCGGCTTTCCCTGTGGTGCTTCAAGGCTCGGACTCTTGCTGGCAAGATCGCCATCCTCCACTCGATTTGTTTACCCGTGC
TGTGGTACCAGCTATCCTTCGTCCCTGCAGACAAGTCATTGGCCAAACTGGTCGACAACGCCATGCTCCAATTCCTCCACGGTGAAGAAATCAACCCGTC
CAGCTCCACGCATGTCCTACGACTGATCAAGAAGGACATTGTGTTCATGTCGAAGCACGCAGGAGGTCTTGGCTTACACCACGCGCTGAAGTTGTGGGAG
CAACACAACCGGGCCGTGATGATCCGGTGCGTGAAAGCTTTCGCGGTGCCTTCCTCCAGAGCCGGCATCCCCTCTTGGATTACTCCAGGGTACTTCTTGC
TCGAAAAAGCGTTTCATCCTTGGGGTTCTCCTCGGGACCTGCTGCTAGCATGCGGCCACTCCCCCTTCCTCAAGACACTAAAGAAGAGCCCGAATGT