Description :
From Genome Similarity Track
Location :
Scaffold_5:30596- 31983
Transcript NameFunction/comments
Phypl_g222dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein

Sequence
1387 bases(100 bases per row)
TCCTCGATTTGCTCGGCGATAATGCGAGCTACGTATCCGTCGCCTACGATGTTGCACACAGTCACAAGCCGCCCGAGGAACCAGCTGATGGCCACCAAGT
AGCTGTAGCTCGCGGGAATTTCTTCGCTGGGGTAAATCGTCGTCCAGATGGAGTAGATCATGACGACGCTTGAATTCGGAATGGGGGCCGTTCCCATGGA
TCCCAGCACGGACAAGAGCAAGATGAGGATCAACTGCAGCCAGCCCAACGGGACTGCATTCTCAGTTGTGGAGACCAAGAAAACTAGAGCACATGGAAAG
TAAATGGCTGAGCCGTTCTTGTGCAGGATGCAACCGATGGTGACCACAAACTGCAGCAGACTGCGCGGAACCTCGCGGGTGGACTCGACGCACCGCAGCG
TTACTGGCAGCGTCACaagcgatgacgacgagccCAGTGCAAACATCGCGGCTGGGAGCATGGCGCGCATATATGGGAAGGGATTCTTCCGTAGGGTCAA
CCAGAGCAAGATGGGGAAGAACACCAGCTCGAAGATGACAATCGAGAGAACCGTGCAGAGCACGAGTACACCCACGTGTCTTGCCGCTTCGCCCAACATA
TCCTGTCCCGACAGCGAGCCAGCCACGAGTGACATCACAGCAAGCGGGCTCCAGTCAATGGCCTTGCTGATCACGCGGAAAAATACCTTGTTCATCTGCT
TGAGGACGTCGAGAAGAGGGCTGTTCTCACGGGAGCTCGTTCTGATCGCAGCCGCTCCAAATGCGATGGCGAACGTGGTTACACTCAGTATCAGCCCTTG
CTCGAAGCTCGAGAAAATGTTGGATGGAATTAGTTGGTTCAGAATGTCCGTGATCTGCATGGACACTGTAGTAGCGGCACTTGCTGTCCCATCCGTCAGA
AGCACTTTTGTTGGGTCGTAAAACTCGAagcgcgtcttgctgccaGCTGAAGTTGCAGAGCACGAGGCTGCGCCTGTGGAATTGTACGTAAAAAATCTAC
CACCCTCGCACATGAGATCAAAGAATGCCGAGGATGTCTCGGCGGCTACGCCCTTGGTGTGGGGCACGAGGCCACGCAAAAGCATCGATATCGAGAGCGA
CATCATCGATCCTATGAGCGACAAGCCCGTAAATATCAGAGCCGTGCGAGTGCCAACGATCGAGACTTTTCCAAGCAGCACAATGTCGGCCACGGTGGTG
GACAAACTCGTGAACACCATGGGGACCACGAAGCACTTGAGCACCTGCAGAAACACTTTTCCGGGAAGGTTGACGAGGCTGCTGACATCGTCCGAGACGT
TCAGGTTGGATAGAATCATGCCCAGGACTAGACCAGCTATAGCGCCCAGCATGATCTGCGTCGTCGACTCTCGCAAGAATGCGCATC