Description :
From Genome Similarity Track
Location :
contig_42:30595- 31690
Transcript NameFunction/comments
g7682.t1hypothetical protein PHYSODRAFT_471542

Sequence
1095 bases(100 bases per row)
GTCAGCAAGTTCCCCTCCGGACGGGTACTTCCCGCCGGTGAACCTCACGCCGGCCGAGATCGAATGCTACGAGCAGCGCGTCGAGATCATCATGAAGAAC
GCTCTGGCCGAATACAATTTGCACGAGGCCATGGGCGCCCGACCGGACTACGGCTCCCGATGGACCGTCGTGGGAAACGTCGAGCATCTCACTGCCATCC
GCGAGGTGGATCCTTCCAGGGCAGTCGAGGCTTCGCGCGTGTTCGGACGCATCGACGGCGACTACCGCAGCTTCCTCGACTTCTACTACTCGGTGACGGA
CCAGCAGGTCTTCGCTGTGAACCAGTTCATGTTCGGATACGCCGTGGACGCGCGGTGCTGGGCAACATCCACACGAAGGAATCCAACAAGCCCCACATGT
ACTTGGGCATGAAGTGGCTCTGTTTGGACCCGTCGACGCTTTCACGCAAGCGCGATATGTGCTACCTTGAGTACCTTGTCTTCACCAAGGACCTCCAGGG
CCGAGACGTCGGCGTCCGCATCACGCTGCCGCTGCTCCTGGACGAGTGTCCGCCCATGCCGGAAAAGATGAAGACCCGGCGGATTCACTCGCACGCAGTG
ACTATCGTTCGACCGGAGAGCGACAACGCCGACGCCACTCAAATCTTCATGACGAGCGAGGTGGACATGTACAAGGGGTCCACGTCCTCATCGGTCGCCA
CGTTCAAAAAGCTCATGACGACGCTCAGCTCCATGGCGCTGTTCGCCGACTCGAAGCGCATTTCCATGCAAGGCATGCTGGACCGCCGCAATTGGGCGCC
CAAGAAGGCGTGCGCGAACTGCACTGTGTGCAACCGCAAGTTCTCAACCACGCGACGCCGGCAGCACTGCCGTCTCTGTGGCGAGGTGGCCTGTCGTCGG
TGCATGATAATTCGTGATGCACCATTGCTGAATGATAACGCTACTGTGGCGCCACGGACATTCCAAGTTGTCAAGACGATGTTCTGCAAGGCTTGCATGG
GGAAGGTTCGAGGCAGCGAAGTCAAGTCTATCACCAGCGGCGACAGCCAGGACGAAGGCGTATCGGACGCCGAGTCCATGAGCTGGTTCCCGGAC