Description :
From Genome Similarity Track
Location :
scaffold_212:30594- 32116
Transcript NameFunction/comments
Pl_107623hypothetical protein PHYSODRAFT_293408

Sequence
1522 bases(100 bases per row)
ATCACGCAAGCGTCGGATTTTACCAGAACATTCGGTTAGCTGCTGATGCATCTTTGCTAGTGCCTTTCGATCCTTCTTCTGGCCATTGTTGTCTTCCGGT
TTGTTGTGAAAATCATGGATAGAGCTCCGTAATTGCCGCTGTGTATCTTGTAGTGAGTGCAATTGCATTGCCTTCGGATGAATCGCCATCTCACGCCGGA
TAATATGTGGTAAGCAGACAGAATTTACAATCTCAGACGCATCTTCACCTGCATTTCCGAGGCGGACAATCGAGATCCTTTCCTCAGAGAGAGACTCCGG
ATGCACGCTCGGCGCTCGGACTTTTGTGATGTTACCATTGCTATCCATCAACCCGTCTGTAACGATTCGAAGCACCAGCTCATTAACTGCACCATTGGAT
GGAGCACATAGAAGTATGTTGTTCGTTCGACTTGCCGAGCGCTCTGACGCAGCTCTTGATACAATACGGCGCTTTACCACCAAACTTGAACTTGTATGCT
GTGTCCGATTAGATAGTTTGTTTTCCAGTCGACTGCGTGATGAACCGACATTCTTGAGTGACTGAATGGTTGTTCGACTTGGTACAGCCGAAGAAGGGTC
TGAAGGACGACGTAGAATACTCCCCAGAGCTGACGTAACCCCGCTCAAAGAAAAAGTCGATGCTGCAGCCCGAGATGATGTCTGTCCACCAGGTTGTTCA
GCATTCACATCACGAGATCGAGCAGCTTCGAAGTTGTTGAAGTTTCCCTTGGAACCGCTTCCTTGAGCGTTAGGGCTGTTTTTCGGAGTAATCATCGGCA
TCACTGCAGTAGCTGGTAGCCGCAACGACAATAAGCCGCTGAGGAGGCCCATAATCGTTTTTGTCTTGCCTGTTCCTGGAGGACCTTGAAGCAGGGATAC
CCCCATACTGTAGTTATTCAGCACGCTGTGAATAGACTGTAGCTGGGATGAATTGTACTGGGGCTTGATTGCCTCCCACAGTTCAGGAGATAAAAAGCGA
GGGGCATGCTCCAAGACGTCTTTTTTATCCATAAGACTCGTCCACTTCTCTTTTAGTTTTACTGAGAGACCTTTGACTTGTGCGTCATCGTACTTCCGCA
GCTTGTTAACAGCTTTCCCTATACTTGTAGACTGAAGGAAAAATGTCAGTATATCGTCAATGCATCATGCAGTGAGAGCACTTACTCTCAAATCTGTCAA
CTTCACGTCCATCTTATCAAGGCGCTTGAGAAGCTTCACGATTTTTGCGCAACTTTCGCTTGATTTGCTCCCTCGTAATTCGTCCAACACGGACGTGATT
GTAAGGAGCTCTGATTGTGTAGACTTGTAAGCTTCTGGAGTGAGGATGCCTGTTCTCAAGTGCTCGGGGAGCATGTCAACTGATCGAAGCGCAATATACT
CACGCGCAGAAGTAACCAAATTACAGAGTGGGTTTACCTTCCACTCTGAATCTGCGATTGCACTCGCTGCCAATACTTCAGTTGAGAATGAGCGCACACT
TGATGTCGCGTTGTCCAACTCC