Description :
From Genome Similarity Track
Location :
contig_42:30592- 31705
Transcript NameFunction/comments
g7682.t1hypothetical protein PHYSODRAFT_471542

Sequence
1113 bases(100 bases per row)
AACGTCAGCAAGTTCCCCTCCGGACGGGTACTTCCCGCCGGTGAACCTCACGCCGGCCGAGATCGAATGCTACGAGCAGCGCGTCGAGATCATCATGAAG
AACGCTCTGGCCGAATACAATTTGCACGAGGCCATGGGCGCCCGACCGGACTACGGCTCCCGATGGACCGTCGTGGGAAACGTCGAGCATCTCACTGCCA
TCCGCGAGGTGGATCCTTCCAGGGCAGTCGAGGCTTCGCGCGTGTTCGGACGCATCGACGGCGACTACCGCAGCTTCCTCGACTTCTACTACTCGGTGAC
GGACCAGCAGGTCTTCGCTGTGAACCAGTTCATGTTCGGATACGCCGTGGACGCGCGGTGCTGGGCAACATCCACACGAAGGAATCCAACAAGCCCCACA
TGTACTTGGGCATGAAGTGGCTCTGTTTGGACCCGTCGACGCTTTCACGCAAGCGCGATATGTGCTACCTTGAGTACCTTGTCTTCACCAAGGACCTCCA
GGGCCGAGACGTCGGCGTCCGCATCACGCTGCCGCTGCTCCTGGACGAGTGTCCGCCCATGCCGGAAAAGATGAAGACCCGGCGGATTCACTCGCACGCA
GTGACTATCGTTCGACCGGAGAGCGACAACGCCGACGCCACTCAAATCTTCATGACGAGCGAGGTGGACATGTACAAGGGGTCCACGTCCTCATCGGTCG
CCACGTTCAAAAAGCTCATGACGACGCTCAGCTCCATGGCGCTGTTCGCCGACTCGAAGCGCATTTCCATGCAAGGCATGCTGGACCGCCGCAATTGGGC
GCCCAAGAAGGCGTGCGCGAACTGCACTGTGTGCAACCGCAAGTTCTCAACCACGCGACGCCGGCAGCACTGCCGTCTCTGTGGCGAGGTGGCCTGTCGT
CGGTGCATGATAATTCGTGATGCACCATTGCTGAATGATAACGCTACTGTGGCGCCACGGACATTCCAAGTTGTCAAGACGATGTTCTGCAAGGCTTGCA
TGGGGAAGGTTCGAGGCAGCGAAGTCAAGTCTATCACCAGCGGCGACAGCCAGGACGAAGGCGTATCGGACGCCGAGTCCATGAGCTGGTTCCCGGACAA
GTCGCGCACTCGA