Description :
From Genome Similarity Track
Location :
Scaffold_79:30579- 32400
Transcript NameFunction/comments
Phyag_g1698D-isomer specific 2-hydroxyacid dehydrogenase, putative
Phyag_g1699hypothetical protein PHYSODRAFT_298513

Sequence
1821 bases(100 bases per row)
AACGGCTCTCGGGGGCTCAGCAACTTATTGAGACGGGAACGCGTCCGTGGTCTCGATTTCAGCTCCGCTGCAACCAATAGCAACATTCACAAAACGCCTG
GATCGCTAGTTTGTGGGCTTTAGCACGGCATGTCGAGCTCTTGCAGTTGTGGAGTAAAGCTTACTTAGCCAGGTAGTTGTGCAACCGAGGGGTGCAACTT
TGTTGCTGAAAGCAGGACCTGGTTGTGGGAATAACTTCGCGTGGGCACCACTCACAATACTCGAGCTAGTTGAATTGATACCGAGAAGAGACCAGCATAA
AGGTACAGAAGCTAAAGGTGATGATGTTTTTTTTATATAAACTCAAACTCTAATGCCATGCACTCAAGCAAGAGAAGTCAACGTTTAGTACCCGTTAGCC
CAGTCAACAGGATAGAGCATCGGCTGCTCCTTGAGACGCAGATCCAAGTTCCTCACGAACACGTCGGCTACTTCTTCGGGGAGACTCAGCGCGGACACGT
GCGGGGTCAGTAAGACTGCCGGGTGGGTCCACAACGGACTCTCTTTCGGCAGCGGCTCCGTCTCaaacacgtccagcaccgccTTCGAGAACAGCCCTCC
ATCCAAAGCCGCCACCAGCTCTGTCTCCTTGATCACGTCTCCACGTCCGACGTTAATGAACACcggtttcttctccttgcagACCTGCAACTTTTCCACA
CTCAAAAGACCGCGCGTGGCATTCGTACTCGGTAAAACATTGACGACAAAGTCAGCGACACCCAGAACGTCACCAAGGTCGCTCGATACTCGATCGGCGC
TTTCTTTCAGCTtttcagcgtcttctgcactCGTTCGTCGCTTGAACCCGACGACGTTAAACCCCGCAGTTTTCATCAGTCGACCGATGCCTTGGCCGAT
TTCTCCCAAGCCGAGGATGGAGAGGGTCAGTGGACGGAAGGAGCGGTACTTGAGTTCATCCCGAGCGTAAttgtgcaggcgctggaaaGTTTGCACTTCT
AAGAATTTGCGTTCCAAGGCGATGACCCACCCGAAGACGTACTGGGCCATAGCGTTGGGCATGATACCTCCAGCCCTTGTCAAGGTGAAGCTCGGATggg
tcgtggtcgtcgtcaactgctGGAAAAAAGGTTCCACGCCGGCGTAAGTGGATTGGACCCATTTCACCTGATGCAGCAAATTGGGCAGCTCTTTCGGCAA
GAAATGACTGCGGTTCAGCAGTAGTTGGGCGCCCACACTGGCGTCAGCTAGCACGAACTCGGCGTCTTggagcgtctgctgctgcgcggcgTTCAGCGGC
CAGAACTGCGGCGTCGGAACGGGCacgtccacgatctccagctgctgctgctggaagagcgcggcggcggcagaGGACGCCgggagctgcagacgctggc
gcaCAGCGGCGCCCAGGCCTtcgatggacgagatcactGGGATCCGCAGCACCATGTTCGTCAAGAATGCGTCTGCATCAACAGTATTAGCTGTACTAGG
TAGAATCTAGGTTTAGTTTCGATACATAACACTTTTGCGAGGATTCACAATCAAATCTCACAGTTCGATCCATTCGCAAGTACGTGGCAGAGGCGCCTTG
GGAGTCACAGTCCAatcatggcagcagcagcggcggcggagatggcggcggagaagcagcgctggGCAGGCGCCGAATTGCTCGTGTGCGCTATGatcca
attgctgctggtgaatGTGGCCTATCGCATCGACCGCATGCGCgaggcgccgctgctgtccacgtcgtcctgGGCCATTTTCTGCGGACTCGTCAGCGGC
GCATTGCTCGCACTCGTGTCG