Description :
From Genome Similarity Track
Location :
Scaffold_47:305781- 308711
Transcript NameFunction/comments
Phyra_49460predicted protein

Sequence
2930 bases(100 bases per row)
CGGGCGAGTCCAAGCGCTGGCTGCAGAGCCTGGAGAAATGCATCCGCGCCATCGTGAGCATCCGCCTGCTGAGCGTGCGCGCCTTCGACGGCAACGGCGC
CAGCTTCAGCGTGGCCACGGGATTCGTGGTGGACATGGAGAGGGGCATCATCCTCACGAACCGCCACGTGGTGACGCCCGGACCGGTCGTGGCCGACGCC
ATTTTCCTCAATAAGGAGGAGGTGGATCTTGTGCCCGTCTACAGGTGATGACTCACCCTGACCCCATGAACAGAGGGGAGATGGGCTCATTGCTTTTTTC
TTTGCTGTTTGGCCGTAGGGACCCCGTGCACGACTTTGGCTTCTTCCACTTCGACCCCAAGAAGGTCAAGTTCCTGCAGCTCCACGAGATCCCGCTGCGA
CCTGAAGAGGCCAAGAGTGGGTGACGATTAACGCACGAGTTTCTGCATTTTAAGGGGACGTATTGACGGGTTTTGGTGCTTGTTGCTGTGACTTTCTTAG
TCGGTGCGGAGATTCGTGTGGTGGGCAACGACGCTGGCGAGAAGTTGTCCATCTTGCCGGGTATTTTGGCCAAGTTGGACCGCGACGCGCCGTCCTACGG
CTCCAGCACGTACAACGACTTCAACACGTTTTACTTTGCAGCGGCGAGCAGCACTAGCGGAGGATCGAGCGGCTCGCCGGTGCTAAACATCGATGGGTGC
GCTATCGCGCTCAATGCGGGTGGAGCGAAGAAGGCGGCGTCGTCTTTTTACCTGCCTCTGGACCGAGTTGTGCGAGTTCTTGGACTTATTCAGCAGGGCG
TGCCCGTGCCGCGCGGCACAATTCAGACTATTTTCCGTCACACGGCATTTGATGAAGTGCGTCGACTGGGTCTTTCCGGCGAAACAGAGGCGCTGGTGCG
GCAACAATTTCCGCAGGAGACAGGGATGCTAGTGATAGACCAGGTCATCCAGGGAGGACCGGCGCATGATCAGCTGCGGACAGGTGACGTGCTGATCAAG
TTTGCCGATCAGTACGGGGCAACGTTTCTAAACATTGAAGAGTTCCTGGATTCTCATGTTGGAGAGACCGTCGAAGCTCAGTTTCAGCGCGGAGAAGAAC
AGTATACAGCCACCCTGAGCGTCCAAGATTTACATTCTATTACGCCAGACAGATATTTGGAAATTGGAGGTGGCATCGTGCATGCACTTTCCTACCAGCA
AGCTCGCAACGCTTCACTACCTGTCGGTGGCGTGTATCTGGCCCAAGCAGGTCACATGTTCATGAAAGCACATTTGGCCCAGCCCTGCATCATCACATCC
GTGGCGGGGCAACCCACTCCGACATTAGATGACTTTGCGCGCGTGATGGCCTCACTGCCCAACGGATTTCGTACGGTATTGCGCTACTTCATGATTCGCG
ATCGCCATCGTGTCCGCACAGCCTTCATCATGATGGATCGTCTTTGGTTCCCAATGCAGATGTGTACGCGCAACGACGAGGACGGGCTGTGGTATTCCAA
GTCATATATTCAGGATGATACGTCATCACTTGTGGCAGCTACAGACTCCAATCCGACATTTGCCCCAGCGCCATTAAGCTTTCCGGGAGGCAATGCACTG
GGCAAGAAAACGTTGCTGTCCCTTGTAATGGTGTCATTTGACATTCCTTATATGATTGATGGTATTTCGAGCTCAAGCTACCACGGAATGGGAGTCGTGG
TCGATGCTGAGCGAGGCTTTGTGCTTGTGGACCAGAATACCGTCCCCATCGCGTTAGGCGATGTGTTGATTACGATTGCTGCTACCGTTGAGATTCCTGC
CAAAGTGGTTTTTGTGCACCCAGTCCACAACTTTTCGATCGTCCAGTACGACCCAATGGCACTTGGTGCTGTAGCCAGCCACATCAAAAACGTAGTGCTG
GCGGATAAGCCGTTGGAGGTGGGCGAGACAGCCGATTACATCGGCCTCAGTAGTAACTGGACTGTGGTTACCATGAAGTCTGTGGTTACTAAACTAGACC
GTCTTGTGCTGCGCGATTTCCAGCCGCCGCGCTACAAGGCGTGCAACATCGAAGTCCTGCATTTCGATCGTATCACGAAGTCTGTAGGCGGTGTTTTCAT
TGACGACCAAGGCGCTGTCAACGCACTCTGGCTTTCATTTAGCTACCAGGACAGTGCCGGCCGCAAGGAAGTCTTTCGTGGCCTGCCAGTTGAGATTGTT
CGGCCCATCATTGACGAGCTTCAGACGTCTCGTATCCCGGCATCAATCAACATCCTACCGGCGCAGTTGTTGACGTACTCGCTCTCGAAGGCGCGTTCTG
GTCTTGGACTCTCGGACACATGGATTCAAAAACTCGAGGCCTGTTACGAAGACAAGCGGCAGGTGCTCGGAATCAAAAGATGTGCTGCTGGTACGGACTG
TGCCAGTAAGCTTGAGAGCGGCGACTTGCTTCTAGCTGTCGATGGGCAGGCTGTGGTGCGCGATGCAGATGTAGAGCGCGCGGTTGATGGTAAAACAGAG
CTGAAGGCTTTGGTGGTGCGTGATCAGAAGGAAATGATAGTTACTGTAAGCACATCTCAGCTCTCAGCGATGGGCACAGATCGTGTAATTGTCTGGTGCG
GTCTCGTCATTCAGAGTCCGCACTACGCTGTCGCAAGCCTGGGCTATATTCCGGAAGAAGGCGGCGGTGTGTACTGTTCGCGGTGGTGCTATGGATCCCC
AGCGCATAAGTACGGATTGCGAGCAACCATTTGGCTTGTGGAAGTCAACGGTGAACCTACACGCACGTTAGACGATTTCTTGCGTGTGGTAGAACGCCTG
GAAAACCGAGAATCGGTGCGTCTGAAAACGATTTCCATCACACGAAGCCTAAGGTATTCACGCTCAAAACGGACTATCACTACTGGCCTACGATCGAGCT
GCACAGAGAGGAATGGGACTGGAAGTATGT