Description :
From Genome Similarity Track
Location :
Scaffold_413:30576- 32596
Transcript NameFunction/comments
Phypl_g8036hypothetical protein

Sequence
2020 bases(100 bases per row)
GCTCGAGCGGGTTGTTAGTGCGTGCAATAACGTTTTTGCTGTAGCCGTGCACATTCCAAAACTTTGGCGGCAATAGCTCCAGCCACGTGCGCTCGAAGTA
CTTCCAAGACGAATCCCATTTTGTACTGGAGTAGATTATGTTGTCCTTGTTGCATCGCTCCTGAATAGCGCCCTTGACCCAAGTAATGCCCTGTGGCGCG
ATCTTGGTTCTGTCGATCACGGTGAGCATGTTCAGAAGTCTCGGTAGCATCGCAATCTTCACTTGGTCTTTGTGCAAGCGATATTTCAGCATTCGACGCT
TGCATGCTTGTTTGAAATGGAACAAGCACCCGATGATTGCTGCTTGAGGAAACCAGTCGCTCGCGGCGTTGATAAGGGCAGCTTCAAAATCGCACACGAC
CTCTTTGGGCTTGAGAGCCTCCCCGCACGCATTGGAGACGACAAACTGGAGCAAGTTCCAGTACGTGTCGTAGTTCCTTGACGAACAAAGCACGGAGAAG
ACCGGGATGTAGAGCTTGGTACCTCGATCGTAGACCATTACCACGACGCACTGTGCAAACTTGTCTGGCACACAGCGGAATGTGCCATCCACAAAGAGCG
TGATGTTCTCGTACCGAAGTAAATTCAGTAGAGAGGGGTTCGCCCAGCCGATCACCCGGTCCAACTCGCCGTTCGGGTTGCACCAGACGTGGTGGAACTG
CAAGAACATCAAGTTGCTGTTCTTGACGTTCACCAACGGCAGGATTTCGACTCGACCGTGAATGTACGTTCCGTAGTGTAGCGCTCGTGCGTGGTGTACT
CGCTTAATGACTTGACCTCTTGTCATTCCACGGACGGCAGTGTTGTTCTCAGTCGTCCTGTAGTACTTGGCGCTTATCTCATCCCAGATCTGGAGAGGCG
TTGCTACCGTAGATGTCGCCATCTTGTCGACTTCACGCTTCATTGCTGCCGTGACGTCGAGTGCCCCAGTCTCGTCGCGATCTGTAAGCGCTCGGAGAGA
TGGCGGGATGCAGGTGTGTGCGATGCTGTTGGCGAAATCATAGTCCATTACCGCAGCGATAAACTCAAGCTTGGCTCGGCAGCTCTGGCTACGATAAAAA
AACTGCATCGGTGTGTTATCTTGACCTGCGTGTACTCGTAGCCGTTGAGATATAGCTTCGTCCTTCCATCACGCTTTTTGCATGCAGGTGCATCGCCACG
CGAAGCTGAAGACACCGAAGCGGAGCACTACCGCTTGGTGGACAatgagctggtcgaaggGCTGTCAACGCCTGAGTTCCACGGCACGACGTCCGTACTT
GACGAATCCTCGTCTTTctctccttcagcgtcgacggcacCGCTGCTGGCAGTGCCGTCACGCTCAGCTTCATCAAGGGAATCGACGCTCGCTTCATCTA
CTAGGTGGTGGGTGTGGCCGCGGGTGTcttcgccaccagcagcatctggTACGTCGTCATTGTCGTCCCTACTATCGCTGcgcccacgcgctccaccttC
CGCAACTTCCGCAGCAtcacgacgaagagcgaTGTGGCGGGGGACGCGCCTACGAGCACGAcctctcgcagcagcagcacttccggTACTGGGGCGGCGA
GTTCGCGCACGACCACCAGCGTCCCCGGCAGCGGCTACATCATTGCCTTGCTGGTGAGTGCACCCacgcgcgccttctcctgctccaggtgcagcaccgT
CTAGGCTGGGGGTGCGCGCACGGAGGCcttcagcaggaacagcaacGTCGGCGTGGTGGCGGGTGCGCCCACGTGCAGGAGCGCTTCCTGGTTCGTTTGC
TCGGTCGTCGCGCGTCTTGCTTGCTGCGGAGCGTTGGCGGGGAGCCATCGCGGAGACGTCGGTTTGGCACTTCAAAAAGAAAATTGGCAAACGAATGGAG
CAGATGAGACCAAAGTAGTACCTAAACAAAACCTTAAGACCTACAAATGTGATCTCTTTGAAAAACCTCATCTGACCTTGAGGTGGTCTGATCCTCTCAT
GATCTGTAATGGGGCCTTCG