Description :
From Genome Similarity Track
Location :
Scaffold_262:3057- 5185
Transcript NameFunction/comments
Phyag_g40615-methlytetrahydropteroyltriglutamate-homocysteine methyltransferease

Sequence
2128 bases(100 bases per row)
CTCGTCGAGGTCATCCCGCCCGCGCCAATCCCCCCAGCTCCGTAGCCATCCAAATTCCGACATCAAGACATCGTTGACCTGCGACCTGCTCTTCATTCCT
GCATTTGCTCGCTGGCGCGCACTACTCAAGTCCGTCCCAGTCGACTCAAGTTATCCCCCCCTCAACACACAGACACATCAAGATGGTCGCCGTCGATAGC
GCAACGCTGGGCTTCCCCCGCATGGGCCCCAACCGTGAGCTCAAGTTCGCTCTGGAGAAGTTCTGGCGCAACAAGAtcagcgaggaggagctctTCACGG
TCGCGCACgccgtggaggaggccaacTGGCGCAAGCAGCTGGACGCCGGCGTGAACCGCGTGGGCGTCGGTCTCTTCTCGCTCTACGACCACGTCCTGGA
CTGGACCTTCTACCTGGGTCTGGCTCCGGAGCGCTTCGCTAAGGTGCCCGTCGGCCTCTCGCAGTACTTCGCCATGGCTCGTGGCGTGGACGGCATCCCC
GCCCTCGACATGACCAAGTGGTTCGACTCGAACTACCACTACGAGGTGCCGGAGCTCAACGCCAAGTCCACCCCCAAGGCCAACTTCGGCTCGTacatca
gcagcatcaagcGTGCGCTCGCTGTCGTGGGCCCCAACAAGACGGTGCCTGTTATTCTGGGCCCTCTCACCTACCTGGCGCTCAGCAAGTACGACGgcgc
cacgctggacgagctgctggtgaaggTTCTTCCTCTGTACACGGCTctggtggacgagctcgcCGCCCTTGGCGTGGTCGAGGTTCAGGTGCACGAGCCT
TCGCTTGTCGGTGCCAGTGCTGACCAGCTCGCCAAGCACCTGCCCACTGTCTACGGCTCCAAGGACCAGAAGGGTGCCATCCAGCACGACAGCATCGCGC
TTAACCTGGCCACGTACTTCGAGGAGATCAACCACGACGTGTACCAGTGGTTCGCCTCGTCGCCCGTCAGCGCCATCTCGCTCGACTTCACGCGCGGCGA
CAACCTGTCGGTGCTCGCCAAGTTCGGTTTCCCGGCTGGCAAGCGTCTGGGAGCTGGTCTCATTGACGGCCGTAGCGTGTGGAAGTTCAACCCTGAGACG
ATCCTGAGCCAGGTGgccgagatcaagaaggtgctCGCTGCCTCGGACAACACGCAGCTCACCATCCAGACGAGCtcctcgctgcagcacgtgcccTACA
CGACCGAGTGCGAGTCCGCTCTGAACGCTGGTGAGACCGATGGTCTGCTCGGCGTGCTCAGCTTCGCCTACGAAAAGCTGGCTGAGCTTGaggtcgtcaa
gaaggtcgCCGAGATCGGCGAGGACGCCGCCAAGGCCGAAATCGAcgctgccaagaagaactggGCTGTCTACTACGAGAAGAACCCGGCCAAGGCCGCT
GTGCAGTCGCGTCTCGCCGCCGTGACGGAGGCTGACTTCAAGCGCCCTTCGCCGTTCGCTGAGCGTCGCCCTTCGCAGCTGAAGGGACTGCCGGTGCtgc
ccaccaccaccatcggcTCGTTCCCGCAGACCGCGGCCATCCGCGCTCTGCGTCGCAAGCTCAAGGCCGGCGACATCACGCTCGAGCACTACCGTggcaa
gatcgacgagcAGATTGCCTACAACATCGGCATCCAGGAGGCTCTGGGCCTGGACATCCTCGTCCACGGTGAGCCCGAGCGTACCGACATGGTCGAGTAC
TTCGCTGAGAAGCTCAACGGCTTTGCCTTCACGCAGAACGGCTGGGTGCAGAGCTACGGCTCGCGTTGCGTGCGTCCCCCGATCATTTTCGCCGACCTCG
AGCGTCCGGTCGACATGACCGTGCGCGAGTTCGTCGTGGCTCAGTCGTTCACGACCAAGCCCGTGAAGGGTATGCTCACTGGCCCCGTGACCATCCTGAA
CTGGTCGTTCCCCCGTAAGGACATCAGCCGCAAGGACCAGGCCTTCCAGCTTGCTCTGTGCCTGCGTGACGAGGTCGCTGACCTTGAGACCGCCAAGTGC
GCCGTTATCCAGGTAGACGAGCCCGCTCTCCGTGAGGGTATGCCGCTCAAGcccgccaagaaggacgagtacCTGAACTGGGCCGTGGATGCCTTCCGTC
TGTCGACTGCTGTCGCCAAGAACGAGAC