Description :
From Genome Similarity Track
Location :
Scaffold_1341:3057- 4843
Transcript NameFunction/comments
Phyag_g10336hypothetical protein PHYSODRAFT_508680

Sequence
1786 bases(100 bases per row)
TCACTCTTTATTTCGCCTGCTTCCTCCCAAGACCTACGGACGTCTCCAGTGCAGAGCAAGCATGCCTTTGAACGGCCCCATAACCACCGACTTGGACGTG
GCGCGCCTGTCGATCAGCAGCGtgtccaaggccaaggacgtTGAGGAAGGCGGATACACCGGCGTCAAGACCCCCGACGCGTCGGACGCCAAGACCGGCG
AGAAGATCGGCGAGTATGAGGGCGGCGCGCTTCGACCCGGCGGCATGCCCAACCTGCTGAGCAGGGGTTGCTTCGGTGTGATGTTCCAGTACGCTGTGGT
CGGTCTGGTGTACGGTGTCATGCCCTCGACTATCTACCccttcctgcagcagtaccTCAATTGCTCGGGCTCCCAGGTCGCTGCGGCCAAGCAATTGGTC
GTGCTTCCTTGGAGTTTCAAGGTCTTCTACGGCATCATGTCCGATTGCCGCCCGATCTTCGGctaccgtcgtcgtccgtacATGCTCATCGGTTGGATCC
TTTGCATTGCCATGTTGCTCATCATGGCCATCATGCCTATCGGTAAGCCGTACTACACGGTCGCTTCGGACCGCGACGTCCCCGTTGCGGACTACACGGA
CGAGATCAAGGCCCGTATCAACTACGACGCTACGTCACAAGGCGCCAAGTACGTTATCATCATGCTCTTCGCGGCCTGCGGCTACGTGCTTTCGGATGTG
TGCGCCGACAGTATCACGTGCGAGCTTGCGCAGCAGGAGCCCATTGACAAGCGTGGTAAGACGCAGTCGGCCATCTACGTCGTGCGTACTGCCCTGGTGA
TCTTCGGCGAGCTCCTGACCGGCTTCTGCTTTAACGGAGAGGATTATGGAGGTGACTTCAGTTTCTCGTTGAGCTTCCCCCAGTTGATGATCATCGTGAC
GGTGCTTTCCCTTCCGGTGTTGCCCATGACGtggttcttcatccacgaGGAGAAGTCGGAGCCCGCCAACTTCCGCCAGTACATTACCGAGTTCTGGGAG
TTGCTTTGCAGCCGCGCCATGTACCAGGTTATCGCCTACAACTTCTTCGCCGGCATTTTCCAGTCCATGACGTACACGGCCAGCTCCCCGGTCGCTTCGA
TCATGGTGGACGTGACGCCGATCAACAGCACCGTCAGTGACATTCTGAGCAACGTGTTGTTCATGGCTGGTATCATGATCACTTCCAAGTGGGGTCTgca
ctggaactggcgctggatgatcATCGCCACGAGCGCAGTGTTGATTGTCGTCGACTGTGCCGTCGCCATGATGGTGGTCTGGGACGTCTTCCGTAaccag
tggttctggctTGGCCCTCCTAttgtcgtgcagctcccGTACGGTGTCGGCTGGATCATCTCCACCTACGTGGTTGTGGAGCTGGCCGGCGTGGGCAACG
AGGCCGCTGTCTACGGCCTGATCACCACGGTGAGCAACGTCGCGCAGCCGTTCGCGAcgtcgctgacgctgctgctggacggccCGTTCAACATCACCAA
CGACCGCATCAAGGAGGACGACCACTCGGTGCGCTCGGACATCACGTACACGATCATCATCATGTACGCCTCCATGGTTTTCGCCTGGGTGTTCCTGGTC
TGGCTGCCCCCgcagaaggtggagacgcaggagctgctccGCAAGGGCGGCTCCAGCAAGCTCATCGGCGCCATCACGGTCTTCTATCTCATCTTCGCCA
CGATCTGGTCCATCATGACCAACATCATGGCCATCTTCGACAGCACCTCGTGCTTGATCATCGCTGGTGGAACCGGTTGCTAAGCG