Description :
From Genome Similarity Track
Location :
Scaffold_1147:3057- 4060
Transcript NameFunction/comments
g16593.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCACGTCAGCTGAAGCC
AGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTG
GTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCC
AGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGTGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGACGT
CGTCAGGACGACTACACCCTCGTCGTCCTTGTTGGATGACGTGAAGGCCGCATACGCACAAGATGCGGATACGAAGCAGTTGTTGGAGTACTTCTCCACA
CCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACG
ACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACAATGCCCCGACATCGGGACATCCTGGCCGTGA
GAAGACATACTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGTGTGAAG
CCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGGTTTTGGTCTTCCGCAAGACA
ACAAGCGGAGGACTGGTATTGTAGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATG
TCT