Description :
From Genome Similarity Track
Location :
Scaffold_115:30561- 33644
Transcript NameFunction/comments
Phypl_g34623-hydroxy-3-methylglutaryl-coenzyme A reductase, putative

Sequence
3083 bases(100 bases per row)
CGTCACTTTCGCATTCGCCGCCGCatgcccagcagcctctgccTCTGGCGCGCACGATGACCAACCAGCTCTCGgacggcgacgcgctcgtggcgctggc
gaccCCCAGAgcggagctggaagcggcgctggaccagacgctggcgttgctgcgcgcggcgctcaagagcTCGCAGGGCGTGgcgcgcgacgacgcgctg
cagcgcaaggcggCGCAagtgacggcgctggccgcgcaggtgcagcgccagtgcgccgatgccgccgccaagcacttcgagccgctgcagcccaGCCACG
ACGCCCGCGAGAGCTGGGGAGgcgccgccaagcagcaggacgccgcggccgcggcccCACAGCCCTCGGTCTGGTCCGGCTTCTacaacaagacgctgcg
cgagcgcctggacgtgctggcgctcatgTACCCGCGcctcaagacgctcaaggcgGGTGGCGCAGACGCGGCCGCCGACATCCTGCCGGGCACGGACCCG
GCGgccaagctgggcgagctaCCGCTGCGCACTGCCAACCTCATGATCGAGAACTGCAtcggcgtgctgggcgtccCGCTCGGGTGAGTTGGTTTCTGTG
CTTGGGGACTGCTGGCCATTGGCTTGACGATGACTCACGAGTGTTTTGTCTCTGTTGCTGCCGCAGTCTCGGCCTCAACTTCGTCATCGATGGCATGAGC
CTGTCGGTGCCCATGGCCGTGGAGGAGCcctcggtggtggcggcggcctccagcgcggccaagctcgtggctgctgctggcggcggcttcCACACGGCGA
CGTCCGGCAACATCATGACGTCGCAGATCCAGCTCGTGGGCACCGAGGACATCGCGGCGGCTATCGCTGCGATCGAATGCAACCGCGAACGACTGCTGTC
GATTTCCAACACGACGCTGTGCCCCAACATGAAGAagcgcggtggcggcgccgtcgacgttTACTGCCGCGTGGTCAGCCAGACCGCACGTACTGCTGCC
ACTGTCGCGGCTGGCAGTGCCTGGTACACGCCGTGCGAGGACGAGCTTGTGGTGAACGCCTCGGAGTCGCAGACGCAGTTCCTGGTCGTGCACATCGATG
TCGACGTGTGTGAAGCCATGGGTGCCAACATCGTCAACACAGTCGCGGAGGGTCTATCAGAAGAAGTCTCGAAGATCACGCGCAGCCGTGTGGGCCTGCG
CATTCTCACCAACCTCTGcatgcagcgccgcgctcgcaCTGAGTTCGAGATCCCTCTGACGAAGCTCGGGTGGAAGGGAGtggacggcgaagacgtgGCG
AACCGCATTATCGAGGCCTACAACTTCGCCGCTGTCGACCCGTACCGCGCGGTGACCAACAACAAGGGGATTATGAACGGTGTggatgctgttgctgtgg
cCACCGGACAGGACTGGCGCGCCATTGAGTCGGCTGCTCACTGCTATGCTAGTCGCTCAGGGCAGTACGCCTCGCTTTCGCACTACGAGGTCGGCCTTGC
CCGTGATGGCTCTGGAacgcgcgtgctgcgtggcAGCCTGGAAATGCCGATCGCAGTCGGATCAAAGGGCGGCGCGTTGATGACCCATCCTGGTTACACC
GCGACTCACGCaattctgcagcagccgacggCTCGCAGCTTGAGCGGCATCATCGTGAGTGTTGGGCTGGCACAGAATTTCGCGGCAATTCGCGCTATCG
CGGTGACGGGTATTCAGAAGGGCCACATGGCCCTCCATGCACGAAACatcgctgttgctggtggtgcgcCGAGTGAGCTCGTATCAGAGGTATGCAGCta
catgctgctgcgaaaGTCGATCAACGTGGAGACGGCCAAGGAGTACTTGCACGCCCACGCCGTATTCTCGGAGATTCAAAGCAACTCCCCGCCAACGTCT
CCGATCTCAGTGACACTGCCGTCCATGTTCTATGTGGAAATTCCTATTCCAGAGCTGGAGGACACGATCAGCCTGAACATTGCCTTCGAAGCGATTAACA
AGCATCCGCAGTACATCGCGATCATGGCGCCGATCGCTGCGAAACAGGCTgacaagacgctgacgacgctcCAGCGACAGTTGCTGGGCGATAAGGGATA
caaccagctcgagaagatgtTCATGTTCCTGGCATCCATGCGCTCTATCGTCatctcggcctcgagctcggaGAGCGATCTGCTGGTGTCGCGCTCGAAC
ATCGGACTGCagaacaagctgcagctgctgtccatTCTCATCAACATCATTGCATACCGTCTCATGGAGGTGCGCCCCCAGAAGGTGCGCACATTCATGC
GGCTGCTCCTGGAGGCAAGCAGCGGATCTGCCAACGGAGCAAATGGCGGCGAGatgcacgagctggacgccaagttcttccACGACCTGATGGTGGAGAA
TGTGGAGCCTGGTGACGAAATTCTGGCGACGGGTTTGCCGCTGTTCCTCGCTCTGTGGCAGGTGCTGCACTACCACATCGAACAGGAGGTGCCGCACAAG
TTGCTCCGTGCTCGTCTTGTGAAGGAGCAGTGGGAGTTGTTGAACGACATCGTCAGGAGTTACGAGCTGGGCACGCTTTCCAACGACACCGCCGATGCTA
CTGATGCTACTGAGCAACCGCTCGGGGAGAAGTTCCTGGCGTATGTGGAAGTGCAAGCTACGCGTTGGCAagcgacgttgctgctgctgatcgactCGCT
AGCTCTGGCCTCGGAGCTGATGACACCGGAGCGGTTGGACTTCCTCACGCGCATCGGCGAGTACATGGAGTGGGAAGGCTCCATCGCACACGACCTGGCA
CGCTACCAGCGCGATGCTACCGAACGCGTGCCCAACGCGTACCTCTTCTGGCTTTCTCAGCGCGGCATCCCTCACTCGGAAGGCAAGAAGTACGAGCGTG
AATTCCGTGGCGTGGCCGACGCCTTGGCTGCCGATAAGTGggaccagctgctgcaggaggcgcgACGGGACTCGTGGgctgccgccaccttctcgttgCC
AGCGGTGGAGCGCGTCATCGGCCTGGTCCGCGAGATCTACGGCGACCACAGCGGCCGCAGTATCCGGAAGGAATCCTTTTAGG