Description :
From Genome Similarity Track
Location :
Scaffold_125:30538- 33490
Transcript NameFunction/comments
Phyta_totarag4121hypothetical protein

Sequence
2952 bases(100 bases per row)
cagacgctggagctgctgcgcgcggCGCTCAAGACGTCGCAGggcgtggcgctggacgacgcgctgcaccGCAaagcggcgctggtggccgcGCTGGTCG
CGCAGGTGCAGAAGCGCTGCGGCGCCGCCAATGGCTGCAAACAGTTCGATCCGCTGCAGCCCAGCCACGATGCCAGCGAGGACTGGAGCGGCGCtgtcaa
cagcaacaagcagcagcagcaacaggacgTAGCGCCACAGCCGTCGGTCTGGTCCGGATTCTAcaacaagacgctgcgcgaGCGCTCGGACGTGCTGGCG
CTCATGTACCCGCGCCTCAAGAGCctcaagatgcagcaggcggGTGGCGCAGACGCGGCCGCTGACATCTCACCGTCCTCGGACCCGGCGACCAAACTCG
gggagctgccgctgcgcaCGGCGAACCTCATGATCGAGAACTGCATCGGCGTGCTTGGCGTCCCGCTCGGGTGAGTTGCTTGGGCTGGATTGGGTCATTG
GGTTGATGACTAACGTGTGACGTGCCTATTGCCACAGTCTCGGCCTCAATTTCGTCATCGATGGCAAAAGTCTGTCGGTGCCCATGGCCGTGGAAGAGCC
CTCGGTGGTGGCCGCAGCCTCCAGCGCGGCAAagctcgtggctgctgcaggcggagGCTTCCACACGGCGACATCCGGCAACGTCATGACGTCCCAGATC
CAGCTCGTCGGCACAGAGGATATCCCGGCAGCTATTGCAGCTATCGAATGCAACCGAGAGCGACTGCTGTCGATTGCTAACACAACGTTCTGCCccaaca
tgaagaagcgtggtggcggtgccGTCGACATTTACTGCCGCGTGGTCAGCCAGGCCGCACGGACTGCTGCCACTACTGCCACTGGTAGTGCCTGGTACAC
TCCGTGCGACGATGAACTTGTGGTGAACGCGTCTGAGCTACAGACGAAATTTCTGGTCGTGCACATCGATGTGGATGTGTGTGAGGCCATGGGTGCCAAT
ATTGTCAACACAGTTGCTGAGGGGTTGTCGGAAGAAGTCTCGAAGATCACGCGGAGTCATGTGGGCTTGCGCATTCTTACCAACCTCTGCATGCAGCGTC
GTACTCGGGCTGTGTTCGAGATCCCTCTGAAAAAGCTCGGTTGGAAGGGAGTAGACGGCGAAGATGTGGCGAACCGCATTGTCGAGGCCTACAATTTTGC
TGCTATCGATCCTTACCGCGCGGTGACCAACAACAAGGGAATTATGAACGGTGTGGATGCTGTAGCAGTGGCTACCGGCCAGGATTGGCGCGCCATCGAA
TCGGCCGCGCATTGCTATGCTAGTCGCTCGGGGCAATACGCGTCGCTTTCGCACTACGAGATCGGCCTTGCCCGTGACGGCTCCGGAACACGCGTGCTTC
ATGGCAGCTTGGAAATGCCTATCGCGGTCGGATCGAAAGGTGGTGCGTTAATGACCCACCCTGGTTACACCGCCACCCACGCGATTCTACAGCAGCCGAC
GGCTCGCAATCTAAGCGGCATCATCGTGAGTGTTGGGCTGGCACAGAACTTTGCGGCAATTCGCGCTATCGCGGTGACTGGTATTCAGAAGGGTCACATG
GCTCTCCACGCACGAAAcattgctgtcgctgctggcgcgcCCAGTGAACTTGTGTCGGAGGTGTGCAGCTACATGTTGCTGCGAAAGTCTATTAACGTGG
AGACGGCGAAGGAGTACTTACACGCTCATGCCGTGTTCTCTGAAATCCAGAGCAACTCACCGCCAATCTCTCCGGTCTCAGTGACGCTGCCGTCCATGTT
CTACGTGGAAATTCCTATCCCGGAGCTGGAGGGCACGATCAGTCTCAACCTTGCATTTGAAGCCATTAACAAGCACCCACAGTACATCGCTATCATGGCG
CCGAACGCGGCTAACAAGGGTGACAAgacgttgacgacgctgcaaCGACAGTTGCTGGGCGATAAGGGCTACAAccagctcgagaagatgttcatgttct
tggcctccatgcgctccatcgtcatctccgccTCGAGCACGGAGAGCGATCTCCTGGTATCCCGCTCGAACATCGGCCTGCAGAACAAGCTACAGCTGCT
GTCCATACTCATCAATATCATCGCGTACCGACTCATGGAGGTGCGCCCACAGAAGGTGCGCACGTTCATGCGGAAGCTCCTGGAGGCGAGTAGCGGGTCT
GCAAACGGGGCCAATGATGGCGAGATGCACGAGTTGGACGCTAAGTTCTTCCACGACCTGATGGTGGAGAGTGTGGAGCCTGGTGACGAAATTCTTTCCA
CGGGTTTGCCGCTGTTTCTCGCTCTGTGGCAGGTGCTGCACTACCACATTGAACAGGAGGTGCCGCACAAGCTGCTCCGGGCTCGTCTAGTAAACGAGCA
GTGGGAACTGCTGAACGATATCGTCAGGAGTTACGAGTTGGGCACGCTTTCCAACGACAACGATGTGACGGCTGCTGCAAAGCAACCGCTGGAGGAGAAA
TTCCTCGCGTATGTGGTAGTGCAAGCTACGCGCTGGCAAGCGACATTGCTGCTCCTGATCGACTCGCTGGCACTGGCCTCAGAGCTGGTGACACCTGAGC
GATTGGACTTCCTAGCCCGCATCGGTGAGTACATGGAATGGGAAGGCTCCATCGCACACGATTTGGCACGCTACCACCGCGACGCTACCGAACGTGTGCC
CAACGCGTACCTCTTCTGGCTCTCTCAGCGCGGGATCCCTCATTCGGAGGGCAAGGAGTACGAACGTGAATTCCGTGGTGTGGCCGACGCGTTGGCTGCT
GATAAGTGggatcagctgctgcaggaggcgcGACGGGACTCGTGGGCTGCGGCTACCTTTTCGTTGCCAGCGGTGGAAcgcgtcatcgtcctcatccGCG
AGATCTATGGTGACCACAGCGGCCGCGGCATCCGGAAGGAGTCCTTTTAGGG