Description :
From Genome Similarity Track
Location :
scaffold_250:30530- 32969
Transcript NameFunction/comments
g6314.t1 hypothetical protein PHYSODRAFT_553660

Sequence
2439 bases(100 bases per row)
GATGCTGAAGAATTTGCTTCAGCCGAAGTTCTATTCAAGAAGCGACAACGCAAAAAGTTTTTCCAGCATGGCATTCAGGAGTTCAATAGGAAGCCATTGG
CAGGAATCAAGTACTTGCAGCAGAACACTTTCCTTCCCACGCCGCTCGACAGCCTGTCGCTGGCAACATTCTTGCGATCCCTCCCTCAAGGTCTGAACAA
AAATGCAGTGGGTGTCTACTTGGGTGCCATGGGCAAGGAAGTTAAGGGATTCGAAAAAACGGAGATCCACGAGGCCGATTCTATGGATTTCCATCGTGAT
GTGCTTACCAACTTCGTTCGGTCGTTCAACTTTGAAGGCGAAAGTATTGTTGCTGCGCTGCGCATGTTCCTCGCAAGTTTTCGACTTCCTGGAGAAGCAC
AACAAATTGACCGTATTTTGAACACCTTTTCACTTCAGGTGTACGAGCAGTGTCGGGAACGATTTCTCATGGCATCAGTGGACGTGGCGTATTTGCTGTC
GTTCAGTCTGATTATGCTGAACACTGATCTGCACAACCCGAATATCCGATTGGACAAGAAAATGAAGTTGGTGGACTTTATCAAGAACAACAAGAACTAC
GGCCAGGAGGTTTCAAAAGGTCTAGATTTGCCTGAGGACTTTCTGACGGAGTTGTACAACATGATTGCGAAGGACGAGATCAAGACATTTGAAGATGGTG
GCAAGCATGGCGAGGTGACAAGTGATCGATGGAAGGACCTACTGAACCAGGCAGAAAGCGACCCGCGCAACTCTCGTTTGATTGTGCACCACCCATCGCT
ACAACTGCGTTCATCAAGCACGCCTCGTGGCATTGGCGTTACCCAAGGCGTATCATCGCCACTAGCTCCTGATGCAATGCGAACGATGAAGCAGGCTCGA
CTCACGAAAAGTGCCTCTAGTCCCGCTAACGGAGCCACTATTTTACCCAAAAGCGGAACGTGGGAGCAGCAGACTCGTTTCGAGGGACTTGTTCCTCTTT
ACGCGTCTTCAGGCAATCAGTACGACCGCCACATCTTTGAGTTGATTCAGCAGAGCTTTGTACGAGCATTCAGCAGTGTATTCCAGCAGTTTGTTGTGGA
TTCCCAAGCAAAAGACGCGGCTCGAGGAGAAGATCTCTCGGTTGGCAGTAGCTATGAGATGCACTACGTGCCTCAGAAAAGCGCTCTCCAGCTAGCTTGC
AATGGTTTCGTGCTGTGTGCAGCGGTGGCATCTCACTTGTCGTTAGCGGAGCACTGCAACTCGCTATTTATCCGTCTTTGCAAGTACACGGCGCTGTTTT
CGTCGGACATTTACCCCGTCGGATATAACGGCCGTGAAAACGGTATCTGGGTGTATTGCGACAACCAGAGCGCCCCGGTCGCGACTGCTGCCGTGCTTAA
ACTGGTCAGCACGTGCAGCTTGTCCCTGCACAGCCGCGCATGGAAGTATTTCTTCCATGTCGTGAGTGGTTTACGTGAGTTCCACGTCTTGCCATCTCGG
ATTCTGTATCCAAGCGACGAAATGAAGCTGGAGCTTATGACGCCCGATGAGCGCCTTGAATTTATTGACTTGGTGTACCAGAACAAGGAAGAGCTGGAAA
GGAAGATCGCGCTTAGTGCTCAAGACCAGGAAGGCGAAAATGGAGATGCGGGTGGATTTTTTAGCGGTGTGGCGTGGTTGTTATCTGCACTGGATTCCAA
TCTTGGTGGCTCAACTCCTGGGTCCATCCCACCAACGAAGTCTCACCTGTCACCGGGGTTCGAGCAATATCAGCTTAGTCCTGCTGAGCTAGCGTCGCAC
ACGGAAGACCTTGTGATCGAGGGAAAGATGAGAACGAAGCAGTCTTCAGATGTTGATCACGACCCTAAAGGCGACTTTGGCACTGACCAGTGGATTCGCA
ACACATTGCAGCCATACCGTCTCGAATTTCTGATGCAAGATGTAGCAAGTTTGCCGTCACGTGCCCTGGCTGAGGTAATCGAGGCGCTGCACGACGAGAT
TTTACTGGTATTGCGAGGGCTAGATGAAAAAGAATCTCAAAAAGATCGAAGGAAGGCTACAAAGCTGTCTCTCAGCCAGGGAGGCTGTGTGCTATTTGAG
CATTTGCTGAGTCAAGTGATCGCACTTAGTGGATCGCTGTTTGATGGCGGCGCAGAAGATGAAGACGGAATATCGGCAGTGTTGGAGGCTCACTACACCC
AAATCCTGGAGTTTTTGCGGCCAGTGTTACTCACCAACTACAGCCTAAGCGGGGTGACGTACGAAAACGCGTGTTTCCTGCTACACAAGTCGATTAACGG
TTTATTCGCTTGGGTAACGCGTACGCGTAGTGATGCAAACGGATTGCTCCTGGTGAACTTCTTGGGCACTTTGATGGAAATGAGCGGTGATGACGAGCTG
ATTCAGCCGTTCCTGACTCCAATTATGTGCGGGTTGGAT