Description :
From Genome Similarity Track
Location :
scaffold_62:30529- 32273
Transcript NameFunction/comments
Pl_110748hypothetical protein PHYSODRAFT_558741
Pl_110749hypothetical protein PHYSODRAFT_543712

Sequence
1744 bases(100 bases per row)
GAGTCGGCGCTGTGCCAAGACGAAATGCTTCTCGCAGCTGCGGTGAGCGTGTCTGCATGACTGCTGGAAGTGTGCCATTCAACTAACCAACGATTGAACT
ACAGGAGGGACCGTCGGGAAATGGCGACCCCAGGAAGAAGAAAAACGACCCGGTGGAGCAGATTATCGATGTGGTGCTGGGTAACTGCGGCGAGCTCACC
CTGGCTGGTGGACTGGGCTTCTGTTCGGGTTACGCACTGAAGCAGATTGGTAAGGCCGCAGCAGTAGCAGTGGGAATTGTCTTCATCATGGCACAGACTG
CTGCCTACAACGGCTACATCGACATCAAGTGGGGTAAGGTGCAGAAGGACATGATTGCCAAGGTCGACCCTAATGGAGACGGAAAGATTGACAGCGACGA
CGTCAAGCTCTGGTACCGAAAACTACTCAAAATCATGAAGACCAACCTGCCGTCTTCCACAGGCTTTTCCAGCGGGTTTGCGCTTGGCATCTACTACTCG
TAGACGCTGTACTATGAACAGTGAGTGCTTCCCGGGCTCGTCTTCTTTATCTGTAAGACTCTGACTCTGAGCAGTTTGATGGTGGATAAAACTTAAACAT
AGCATTGGTACAGGATGGCTGTGTCTTCCTACCTACTCGGTTGGGAAGGCTTTGGCTAGAAAACCGACGATAATGGAGCGGTCATCCGCGCTAGTTACAC
CCATACTTTTGAGCTCACGCGAGAATGCTGGTACGCTGCTGATCCCGTTACTGATAAGGTTGAGTCCTAATGTGGCGTATAGGATGATCTCTGGCCGAGT
GAACGATAAGAATGTTTGCTTTGCACTCTCGGAGCACGTTGGAAAGCAGTCCTGCCACATCTTCTCTCGTAACCGTGACTTCATGTCGTTGTCTGCAACC
TGCACCAAGCAAAAAGGGCATTAGCCACAAGTCAGCCACATCATGCAGCTGTTGAGGACCGTACCGATACAGGAATGGGTGCAGGCATCTCGGCTCCATC
TTGATCTGTCTGTAGTATAACCAAATATGCATCGAACGTGTCAGAAACTGGAAGCAGACCGCTTTCATGGCTTGCCGAGAAGGGGTGTATGGGCCCTACC
GACAAGCCAGCTTTACGGAGGTCATGGGCACGGAGATGGAATCCCCGTGCGGTCAGCTGCGTCGCCTACAGCAAGGACAGCACCAGCCAACCGATCACAT
CCCTAGCATGGGTATCGTCCCGCACTATAGGTCTACTAATGCAGAAATCGTACCGTCGGGTCCTTCTCGATGTAAATCCTGTACGCCTCATGAGTCCGCA
ACCGCGGCGTGTACAGCTTGGTCTTCCATTCCTACAAGGAGAAATAACAAATTGCATTAATTTATCACTGAGTCAAATCGAAGAAGAAGCTTCTCGCAGC
ACCTCCGTCTCGTCCTCGTCGTAGTCGAATTCAATGGGTGCGATCCACCCTCGCTCCAATAGTCTGGCCAGAATATGCCCCGCCATTCTTGTTCGCGCCT
CACCCACCAGCGTCGTAGCTGTGGCAGTGGCCGTCGGTGCAGTCGACGTGTTGCCATCCACGACGAGGTCCGCGTCGCTCTGCTCGTGTTTGGTCGTCGT
CATCTGCGTGGTGAAGAGCTGTACGCCGTCGCGCTCCAGCCATTCGCGCAGTACCGTCTCCTCCATGAACTCCATGTCGTTCTCATCCGACGTCTCCAGG
ATGCCGGCGTGTTCTAGCAGCACCACGAACTCGTCCTCACTCAT