Description :
From Genome Similarity Track
Location :
Scaffold_396:30526- 34495
Sequence
3969 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCCTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCCGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGTAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TGTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTAGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTG
GCGTCCCAACCATGTACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAGCCATTGTCTTGACTGACCTCTCTTGCTGACCGTTGGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGAAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAATCCCGTGAAGTGGTCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGAAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
GTAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCG
GCTTTGACTCGGTGATACGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGGTATGGAGTTATTCGTCGACCATGGTTGACGGAATCA
CCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCAAGTCGGCGGGCTTCTATCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGCG
ACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCCAATTCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCCT
TCGCGATTCGTCGTCTCCGCTCAGTCTGTACCGTCACTGGATCAATGTCGTTGGCATTCTAAGCTGTCTGGGCTGACTCCATCTGCGACCCTGTTTCGAC
ATTCGGGGTCGTGTGGTTAATCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCTACTGCTTTCAAACGCGGATGCTCCAGGATTGGTAGAC
ATGGCTTCATGATCCTGACTTCCTCCTCTTGCTCTAGCCAAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGACTGCCG
TGACAATCGGTGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGCTACGCAGTTAATCATTCTCAGCTCTGCTTTCCTATCCGTCCCAAGAATTAC
TCGTCCGGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGTTTC
GTGAGATCCTTGTGCCGGGCTAGTTCCACTTGCAACGTGTCCTTCTTGCATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACCCACGA
TAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACT
CGCAGCAATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTGCCATACCCGCCGTATTTAGCCGTCTTCGCTGAGCCATCAAATGAC
AGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGTGCCAGGTGCTTCA
AGGAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTTGGCGAAGTCTACATCTCGCTCACGTACTCGTTTCACCTTCAAATCGTAGGG
CGACAACATAACTGCGAAACTGACTGCGCGACCGTACAGCGACTTTGACTTAAACACCCACTCCAGCGTGGAGAAACGGGTGTAGACGTGAAGCGTCTTT
CCCGCCAAGAGAGTGTAGCACACTTTCAGTAATTGCAACAGCGCGACTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCGTTCTCCTTTAGTACGCGTC
CGCAAAGGCGAACTGGGTGCAGCTTGTCGTCGTGTGATTGCATCAACGTACTGCTCAGCGCCCACTCATTGGCGTACAACATTATGTGGACTTCTTTCGC
CGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGATGCTTTTGCTGACGTCAGGTCACCCCCAGGGCCAAAGTCC
GTATCCTTTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCTCCTTCT
TCGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGT
TTGGATAAAGATACTCTTGGTAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGCCAAGCAGGCGTCGAACGTCTCCCCTCCAAAACAG
ATATCATCGACAAACGACCTCCGCTTGAACACTGGAATCAAGGAAGACTGGTCTGGTTCTCCATAAGCAAACATATCGCCGTCCGGTCCGTTGACCAAGT
CTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTTCGTTGAATCGCTGACTCCGCCGAGCTCTACTCGCCG
AGCTCCCGACTCGGCTTCAGCAATGGTCATCCGTTCGGTAAACAACTGCCATCCTCCCTTTGGTTGAACGTATCCCCATAGAGCGTTGTCGATCAGTCGC
TGGTAAATCATAGGCGCATTCTTCAATCCAACGGCATTCGTAACCATTCAAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCGAGCTCGGCGTGT
CATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAGCTCTCCAATATGGTAAGCAGGTCATCGACCAGTGGCATAGCGTAT
TCCATCGGCGTCGTGACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAATATCCACACCATTTTTCTTGAGCGCTATCACCACTGGCGAGGCCCAAG
GGCTGCTCGAGAACGATATCAACCCAGCTCGAAGTAGCCCCTTCAACAACTCGTAAAGCTTACTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTT
AATGGGTGAGTGCCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATTACC