Description :
From Genome Similarity Track
Location :
Scaffold_46:305202- 308228
Transcript NameFunction/comments
Physo_136521reverse transcriptase

Sequence
3026 bases(100 bases per row)
AGGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGTGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGG
TCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGTCTATGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCG
TGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGTAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTACGACTC
AGGATCATGTATGAATATCACGATGCACCGACTGCGGGGCATCCGGGTCGTGAGAAGACATACCTTCATCTCACGCGAGACTTCTACTGGGCCCACCAGT
ACAAATGGGCGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTC
GGAGTGTTGGCAGTTCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAG
ATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACA
TTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCA
GACGGGCGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTTCGCTCACTCGTTTCAACACTGGAGCGAGTGCCTACCGATGGCG
GAGTCCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGG
TGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACAACGCGCAAGAA
GAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGACCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCAGCTCG
GCCGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTGATCGACAGAAGCTGAACGCAGACAACG
TTGGCAGGGGCAACACAAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAA
GCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTT
TACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAACCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTG
AACGCGCTGGGCCAAGCGCACGACGCGGCCTCCCACGTCGACAGAGATGTCTGACGCGGTCTGCGAGCCCTGAGCGACTTGATCCCTCAGGATCGCCACC
CCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGCTCCACAGCAGCAACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATAGC
CGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCTGCTCAACACGTTGGATTGTTGAGCGTAATGTGAGTCATAGTATCCCAAAAACGA
ACCGGCAACCGGCTCGTTATCGAATTCGTTGGAGAGGGTTACCGCCCCACCAAGATACATGGGAGCCCCGGGACGTCCTGCTGCAGGACGTTCCGGAAAT
GGTGAGGGCGTACGAAGCTCACCACGTTCTGCCAGTGCGAAGGTAGAGCGAGCGCTGTAGTCACCTGCAGCGCCCGAAGTCCCACGATCGTCGCGTTCCT
CACGTGCCAGGAACTTGGCACGGAGATCTTTGAGACTCGCAGGTACACGAATCGGCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGG
AAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCGCCCACGCGTCGAGAAT
GTCTCGAAGCGTTCACGGGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGTTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCT
GAGTGGCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTACCGGAGTTCGTGGAAGAGCTCGATGTAATAATCGCGCCTTGGATTCGTTAG
CGGATCAAAGTGCTGCTCCTCCGCCACAGCATTGTCGTGGATGCCGCTGCATACGTACAGCGGGATTTCATTTGGAGGCACGGTGTTGCCCACACGGTCT
GCGATCTCTGACGCAGACGGCATTCACGGATCGCACGATGCTCAGGCAGCGCGCGGGGAGCTTAAAGCCCTAGCAGCAGAGAGCGGAGTGTCGCTCTCGC
CGCGCGAACGCTTCGAACTCGAAGCGTCCGATTCGTCTCTTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTT
GCGCATGCTTGAAGAGGCCTCGCCCTATTCCATTTCCACGTCGCCGTCCCCGTAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCC
GGTTGAGTTGTCCCCGCCGCAGTCTTGGCAGCAAGAGCGTCACGCTTTGCTTTGTGACGCTCGCGGTACTCGGGGATAGAGAGAGTATCTATCCCGGCGG
AGGACTTCCCCTCTGCTGCAGCGTCG