Description :
From Genome Similarity Track
Location :
scaffold_13:3052- 4618
Transcript NameFunction/comments
g790.t1 hypothetical protein PHYSODRAFT_490699

Sequence
1566 bases(100 bases per row)
TTCCACTTCGACACTTGCTGCACGATTACCAAGGACTGCGCGTCGGAGCCCGCAACGAGCGTGTCGGATTCCGCATGAACCGCCAGGGCATTCCACGGCT
GAGGTCCAGAGTAGAGACGCTGCACCTGAAGGCCCTTCGAGAAGCCGTTGGTGGCACCCAACGAGGCGAACGGGGTCAAGTTCTGGTTAACTGCAGATCC
GCTGTAGCGCTCGTACTCCACAGCGTCGCGAGGGTTACGGCCGTGGTGAAAGTCCCAGCAGTTCACCACCGAGTCGTCACCACCCGTGTACAGATAACGA
GGCGATGCTGAGTGGAGCTTCAATGCGCGAACAGCACGTTGGTGGTATGCTTCAGTACGGAGTGGCTCCTCGAGTTTGCGACGATCCCAGAAGCTCACGC
GACCGTCATCGGCACCGGTGATCAGCAGTTCAGGGCGAGTTGGGTGCGTCTCTAGCGTAGTCAAAATGCCCCTCGAGCTAGGACTGTGACGAAGCCATTG
CAAGCAGCATATCAGAGCATATCACCACACATTCAAACGCGATACAGTAACGTACTCTGCGCAGGACGTGACAGGGAACTGGTTGTTCGCCGTGATGTCC
CAAATGCGAAGCTGACTTCCAGGAGTTGAACTGCCACATCAAGAAAATACATCAGCTCGCCATCACAAATGGTACGAGAGGTGAAGCGTACCCGACAGTG
GCGACGACAGAATCCTGTCCCAAGAACTTCACTGCGTTGATCGGCAGTCGGCTCGTTTCCTTGTTCTCTGTAAACAGCCCCGACATCGAAACATGAGCCC
CTGTCTCGCATCTCTTCATTCCTATCAGTGCATTCCCTACCAAGGATTTCAACGCTCACAGCATCATCCAACTTGAGCCACGCCAAAGCTCCACTTGCGC
TGGCAGTCACGAGAGTCGTGCCGTTCTCGCTCACCTCCAAGCACGTGGCTGCAGTGCCAGCGAACACCTTCTCCCATTGCGGCACAGCAAATGCAGACAG
CGGTTTGCTCGAGTCTCCGTCCGTCATAGCTGCGTCGTCGTCCCCAGCACTGGAAGACACGCGGTACGCGAACACGCCGCCCACGGACGACGCACTGACC
AGCAGATTCTCGTCTCTGGAGGCCACAAATTGCAGCGCATTTACGTCTCCCGCATGCTCCGCCTCAGCCAACGTGCTGAGCTCACACGGGCACGAATCGC
CCTCACCACGTCTAGCAATTAAGGGATCAGTCAGTTTCCAGCTGCAATTCTCTCAAAACCAGCTACTGACGCACCCGAACTCCTTGTGCAGCTCCCGCTC
GTCACGTGTGCGACGCGCCGGCAAATGCAGCGATATGTGGTTGGTCTATACAGTGGTTATTGGGTGAATTTGGCGCATGGTTAAATTGTTCCGTGAACAT
CTCTAGTATCTCACCTCGTTGTCCCATCCACCGGTCGCCACCAGAGGGAGAACGTCGTACTCCTCCTGTAGTGTCTCGGAGGCGTAGCGGACGTCGCTTA
CAACGCACACAGCCTTGACCTTCTCGGCCAAGAAGTGTCTCGATACAGACGCCATCCTATGAGCTG