Description :
From Genome Similarity Track
Location :
Scaffold_36:305165- 306596
Transcript NameFunction/comments
Phyin_T30-4PITG_14571Putative uncharacterized protein

Sequence
1431 bases(100 bases per row)
ACCATAGTGCATTTTGCTTCAAGCAGCACAGAGATCAACTACAACAAGAAGACTTCCGAAATGGTGTCGTCACCTCAGCCCTCGTCGACGCTGGACGCTC
TTGCTCCGCCCTTCTATCCTTCCATGACCTGGTACCCTGCGATTACGGACGACTACTATTTGGAGCGCCCGCACTCGCCCGGCAAAGCAGGCTTCGTGAT
CGCTGACCCTGTGGAGCCCGTGGCCGAGATCCCAGATGAGGAGCTGTTCGACCCTGCATACTACCCGCTCTCTGCTACCGAGATGTTGGAGCTCGAGCAG
GTAGACGAGATCAATGAGATATTGGCCGAGCTGGACCTCATGGAGAGCCACCAGGAGCTGCACCACAAGCTCACCCAGAAGACGCGCGAACTGCGCTCCA
GCTCGGACGTGGACGCTGAGATCTACAGCATGATGGCGAAGGCTGCCAAGTCCAAGAGCTTCTCCTCTAAGCAGGTTCATTTGCTGAAGAAGAACAGCTT
CCACTCAAAGAGGAACATGCGCTCAGCGCTGCACCAGCCCCGCTCGGTGAAGTAGAGCCCCCGCACGTCATCCCCCCTTTGACGTGCGGCGGCGCCTATT
TCAACGCAACGGAGTAAGTGAGCCACGCAACCAGCGACCATGAAGAAACTCGCGCTCCATCAGACTTCAAAACGAGAGAAAATAACGATAACCCATCCAG
CTAGCCAGAGTCTGGGTGTACGTCCTGTATTCGCATGACGGACATCGAAGCTTTGGTGACACAAATCATACAACCATCCGACACGTCGTGCTACAGAAAA
AGAGAATTTCAAGTAAGTAGCAAAACACAGGAAAGCAGAAAATAGTTTAGTGACAACGAAAGAGAACGGCATGAAGACGAACAATGAGCAAACAAGCGGC
GCGACGATGGGACTGGGCTGTGAAGTATGGCATCCGGTTGAAGGCAAGCCTGTCAGAACTACCCACCACCCGTGAAAGCAGCGCCCAACTGTGAATCGCG
CAGTACGAGTGTACCAATATTTCCAGAAAAATTATAATAATGTAAGATGGAGCGAGTTTTTCGAACTAGCAACTTGTTCGTGTCACTCCCAGACCTCAAT
GCGTGGTCGTCGAGGTATGAGACTTGGTAGAACTGGCCTAATCTGAGGATTTCGACATCGTCGTCTGGCAACCGCTTGACGGTCTTCGGAGCTCAAGCTT
CGAATGCGACCGAGATTGATCTCGTCAGCGTAGCTTTTCATTGCCGCCTCGTTGTCAAGTAAGCTGTCCAGTAGCCCGTGACTATTGCTATTAATAGACG
CCGTTGCTTGAAATTGCAGATCGGGAACGCTCATTCGACCGCGTCGGCACCGACGGAGCAATGAAATCCTGGCAGCAAGACGGCGCCGAAGTAAGAGTAG
AAATTGGGTTAGTGCGATCGGTGGCATATCG