Description :
From Genome Similarity Track
Location :
Scaffold_17:30513- 51293
Transcript NameFunction/comments
Albla_Nc14021100conserved hypothetical protein
Albla_Nc14021130conserved hypothetical protein
Albla_Nc14021090conserved hypothetical protein
Albla_Nc14021110conserved hypothetical protein
Albla_Nc14021120conserved hypothetical protein
Albla_Nc14021140conserved hypothetical protein

Sequence
20780 bases(100 bases per row)
GATAGTAAAGACGCGCTCGAAAAGATTTTGGAGTTTAACGACTTGCTTCAATGCCTCCCGGAAGGTACACATCGCCTTAATCTGTGATCTGCTTATTCAA
TTCTGATTTTATCCGCAGGTTTGATACCGTCTTCCAGCAGGAGCGAGTTGCAAGAATTGATGGAGATAACACTTCCGATGGATTCCGTTCAGGAGATATT
TCAGCATATTTCGCGAGTGTTATGCTCTACTCCGAATATTTCAAGCTTTTGGGAATCCTATCAAGACGTGAAGAATGTGATACGGCCGGATGATACGACA
GCTGTACCTGGAGCTTTTGAGGCTCGAATTAGCTCTTACATCCAACATCTCCAGAGTCTTTATCATTTAACTAAGAAGGAAAAGTATCAGTATGAACAAC
GATCAGAACTAGCAATCTCCCAGGCAAGTCTACAGCGTAAGATAGCTTCTCCACCGCTCCCTCTTCCGACGCAAGGATGCATAGCAATGGGATGGGATCT
CGCGATATATTTAATTCGATCGACATGGACTGAGAATCCGAAAAGATATGTTGGAGCTATTGACATGATCAAGGCAAATCTGAGGCCTTTAAAAGCTATG
GCGTATGCAGAAACCTCCTACCTTTCTCCATCCGCTTCACATGCATTTAGTGAGCTATCCGACTGTCTGGAAGCTCTTATACATTCAGAGATGAACGCGT
TGAACGAGGAGCGACATTCTTTGACGACATCAACGGCTGAAGCATTGGCCGAAGTCGGTGTTGCTCGCGGGTCTCTAGCCACTCTGCTAACTGTGATTCG
ATGGCTGCTTAAACAATCACCCGACGAACATGTGAATATCTCACCAAGCCTTTCCAAGCTCAGTGCATTAAGAGAGCAGCCAATGTATGGAAAATGTGAA
TCATTTGGCGAGCTTTACAGCTGCGGTCAAAATTCCTACGGTGAACTTGGACTTGGAGACGACATTGAAAGACATCAACTGACGAGCGTTCCGCTGTGTG
GCTGGGATCACATTCGTCAGGTGGTAAGCGGGAATGAGATTCTGGCTATTCTAACATCCGACGGTGTGGTTTTGACCTGTGGTCTGAACAAAAGTGGTCA
GTGTGGTCATGGGAATTTCGACGAGCGTGTGATGCTTCTGCGACCTATTCAGGCGTTGCGCTCTCACCGAGTCAAGTATATCAATGCAAGCAATGGATGT
GAGCATCTCATTGCCATCACCGATACCGGCCTGGCTTACTCGTGGGGCTACAATGACCGTGGTCAGCTCGGCCATGAAAATGTGGGCACTAAGTTGTACT
TACCCAAACTTATCGAAAGCATCAAAGAGAAGAAAATGAAAAGCGCCGCGGTGAGTTATCACCATAGTGCTTTGGTCTCCGTTTCTGGTGAGTTATACAC
CTTCGGGATGAACGATTGCGGGCAACTCGGTCTGGATCATACTCAGCATCAATCAACGCCTCAGTTGGTCAAGGCTCTACTCGGCCACCACGTCAGTATG
GTCAGCTGTGGTCTGTATCATATGGTCTTATGTACTATCAGTGGAGAAGTGTTTACGTGTGGTAAGAATGACCATGGACAATTGGGTCTGGGTCATAACA
AACAAGTTAAGGTACCCACTCAAGTGGTTCTTCCGAACGAACTGGTTTGCTTTGTTGCTTGTGGATACTATCACGCTACAGCGATAACTTCGACCGGTTT
GACATATTCCTTTGGACGAAATGATTATGGTCAGCTTGGAATCGGCTCAAAGATTCATCAGAATATACCTATTGCATTAACGATATCGTCAAATACGCGT
ATGGTACATGCAGCTTGTGGATGTTATCACACACTCCTCATGTCGGACAGTGGCCAGGTCTTCGTGTTTGGTCGGAACAACAAGGGGCAACTGGGAAATC
GTGGGAATACAGACTCGCTGCTACCTGTTCCATTAAAAGTGAGACCCGAAAAGAACATGCGGAGGTGTCTACACATAGCGGCAGGATTTTACACGACATC
GCTCATTGTGGAACGCAAGCGAGAAAATGACGAAGGAGATGCAGTCTTATTGAATGAGAACTGCATCACTCCGATCTGTGGTCGTGTAGATATTGATCGC
TCAGGTGAGGTTGAAGGTCTAAGCAACTTTGGAACCATGTCAACGATGGGCGTATCGCTATTTTGCGGTAAATGGTTCTACGAGGTCGAATTGATTACTT
GTGGTCTCATTCAAATTGGCTGGATCGACAACTACTTTCAGGGAAGCTCAGATCAAGGAGAAGGTGTGGGTGACCATGAGCATTCTTGGTCATACGATGG
TAATCGACAGCGAAGGTGGAATAGCGGCTCCTCTTCCTACGGAGACAAATGGAAGCCGGGAGACGTTATTGGATGCCTATTGGATCTTGATACATACGAA
ATGACATTTTTCCGCAACGGGATCAGTCTAGGCGTAGCATTTACAGATTGTAAAGTCCCTTCCTGCGATCCAAAACGAGGCTTGAGACCAGGAATCAGTC
TGGAGCGTGGAGAGATCGTCAGAATCAACTTGGGACATCAAGCATTTGCCTTCCCACCCACAACAATTGCAGAATTTGACGGTATAGCGAGAGCAATACT
ACTCTCTGCACCCTCGGCTTCTATCAACTCCTTGCCTTATACATCCAATTCGTCCTTTGATGCACCTCCAGACGCTCTGTGTGGGTCAGCAACAGTTATG
GCTGGATCACGGATTTTTGTGATCGGAGGAAGCGCACCTGCTGAGGTCAAACCTAGCAATCTGGTGTGGGTGTACGACGCAACGAGTCATTCCTGGGAAC
GATGGAGTGACTTCCCGCTCAATATCCGCCACCATCAAGCTGTTCTCATTGAGAATACTGACATTCTCGTTCTGGGTGGGGAAGAACAATCGGCCAACTC
TCGTCACATGCACACGTACAAGTGTTCGATCACGCGAAATGAAGATGGAAGCTTACCTCAGTGGGAGTTGATACTGGGGTCGTCAGCGCCTGCACAGCCG
CTTCCTACTTCTCGGGCTTTCCATAGTGCAGCCGTTGTCGATGCTCGCCTCGATACTCTTGTACTTGTATACGGAGGTAGAAATATCGAGGACGTTATCT
TGGACGATGTTTGGTGTTTCTCTCTTGACGACTTTACATGGTCAAGACTACCTTCGTCGACATTTCTGGATCCTGGACCTCGAACAGGATGCTCACTGAG
TGCTACGGGTGAATCTGTGTACTTGTTTGGTGGACTTGATCGAGACGATAATCTTCGCGCTGATTTATGGTGTTTTAATGTCTTTGATCGTGCGTGGTAT
CTGGTTCATGATGATGACATCAATGCTCAGAAAAGCGGAACGACTTGTGTCGCGAATTTTGGGCATGGCTTCATCCCGGAAGCTCGTAAGAACTATAGTT
TGGTGACTGATATTGGAACTGTTTGGATCTTTGGAGGTCAAAATCAAGCAGACGAGTTCCTTGATGATTTATGGTCTTACTCTGTTGCTTCCCGAAAATG
GAATGCTATCGAAATGCATACTGAAGAGGGTAAAAGTACCAAAATTGGCTCTTCTCGCATACTCATTGAACGTGGGGTTGTCACTGCACTTTCATGTGCA
TCCGACAGCAAATATTGTGGAGCAGATAGTCGCGCTTATTTGTATTTGATCAATTTGACTCACCAAGGCTTACCCGTGTACTCTATTTCAGCTTGTAGCT
CACCCGTATACAACACCAAGAATGGCGTCGCAGCCGGGAGATTGTCACATATATCTACGGTTCTACGCTCGCGAACGGGTACGACTACAAGCAATCGAAA
CACTTATTCATGTGCATTCAAAAATCTCGACTCGGGAGTATCAGTTCTGTCCCATTTGGATCGACTTGCGGGGACAGATGTACTTGTGGATGACACAGAG
ACTGTCCAGTTATCCCGATGCAGCTACCGATCTTTGTGCATCGATCCCAAGAAGAAGACGTTTGAGGCTCTTCTTGATCTTTTGTCATCGCTGAATTCGG
CTTTCTCGAAGTGGAAATCTCTTGATGGAGAACGTGAGCCGGACATTCCAGCTCAGGTTGTATTGGAGGTGTTATACCCTTTATTTGTATGTCTACGACT
ACTGAAACTCAATCTCTACGAGCTCTCTCGCTGCTGCCCGGACACAATCAAAGCTGGTCTCTCAAAGGAGAACGAATCAGCTCCGGAAAGAGTTCTCAAT
CTCATTCAACATGAGTTGTTTGATATTGTCGAGCACCCTGTCACCTTACCAGCTACTTTGACCGATGTGACGTGGATTTGTACCGCTGTTGAGCAGGAAA
GTGCCTTATGTATCTATCACGGCTATGCATCGTTGTTTCCCTCACTTGCAGAAAGACTGGACGTCCTCAAGTATTTCTTGCAAAATGGATCGTTGAGGTC
CATTGACTTGGACTTACCGGTGAGCTCTGTGGAAATCGAAGATATATGCACAAGGAAAGGAAGACTTTTGCCAATGCTCATGTCATGCTTCACGTCTCAT
CGAATGCTCTTCCAGCTGATGAGCTACGCGGAAATCACCCCTGGAAACGCGATAGCACCATCAACTTCATTGACAAAAGTCGCCCAAGGACTTTTTGAGA
CGCTGATGAGCAATCTATGGGGACAAACCACCGCTGTGATAGAAAAGTGGACGAGAGAGACTTCTTCCAATACAACGAAATGTGTTGCCGCTTTGGAAGA
GTTGGAACAAGTCGTTCTGTCCGATGAATTCAAAGTATTGAATGTATTACTTCGCGCGAATGCGTTTTGGGTGGCCAGGTCTTTTGATTCAAGCTGGGAA
ACCGTGCAGTTCGTGATCACTAGGATAATCACATACATGGTCAATCTGACAGAAATGGTTTACACAGTCACAGACAACTTCGACAACAGACTTTATCCGT
GGATCATACAGTCAAGCTTTTGCGGCAAAGTACTTCCGTTCTTGATACTCAGCACTTTGTCATTCCAAAACGTGCGAGATGATTTCCATAGTATGGCTGC
GGTTATCTGGCCTCCTATCAAATGTCTTCTGCTTGAGCTGCATGATGCGATCAAGGATATAGATGCTAAATTTTCGGGCTCGATTAAATGCGATCGAGAA
AGATGTTTGGCAGGTACAAAGGACGACCTGCAAGCTTCCAATGTTATGGTTTCTGAGGATCTATCACACGTTCTGTTTGGGCACCCTGCACCAGACGCTG
TGTCATCACACCAGGTCTTGCAGGCTTTATGGACCAAACGAACCGAGCTTGTATCTGGTGGCGACAAGCACTTTGTACAGATGAAAATACCGTCCGACCT
TGAGCATTTGCTTGGTACCAACACGTTGATGGTAAAGAGCTCTGAACTCCCTGTGGATGAAACACAAGTAAACGACCTAAGAACGCTTTTCTCTCCCAGC
TGGACGATTTTATCCCAACATATCTATCCTCTTGATTATCCCCTGGGGGAGGTAAAAGGTGAGGAGGATGAAGAAAGAATGGCGACGACCATTAATCTTC
GCCCATTTCACATGAAAAGCATTCATCATTCGATTGACAGAAGCTATCACTGGCTCAAAGACCTGCGCAATATTCTAGCCTGGGCTGGTAGTCATTACGC
ATCGGCTTTGGTAGCAAGCAATCGATCTTTAATCGATCATGAGCTTGTTAAACGCTGGTTCAAGTCTCCTCTACTTGTCGGTGGTCTAGAAAATGACGTA
ATCGAAAATCCGGGAGCGAGGGAGCTCGAGAACACGCACATTCGGTTCCTTCGGCAAATTGTGGAGAACGAAGGTAATGGGAAAAAGTTCTTGGACAAAA
TACGTCTTGCGCTCGAACTTGGAGGCATCAACAAAGTTCCAACAACAATCAATCCAAAGATTCAGGCTACGCGTTTACGCCGACAGGACAGTGTGGAAGC
TGCACTACAAAAAAGCGGCTCTTTCGAAGCTGTGGACCGCGCTGTCAGATCTACATTTGCTGTCCTACTGAAGCATACTCAAATAGGCTTCATGTCATCC
AGTATGATCATGGAAGGAACTCTATCGCATAAAGTTCTTGATTTGTGGAGAGCATCCTTGCAGCTTCGACGTTGGATTGTGAGAGAACAACAAAAGCTTG
CCGCTTCAATAAGGTTTGTATTGTCAACTACTTGTTGTTGTTACGTATATTTACACCTCTTTTAGCGACAAGAAAGTGGCTTCGGTGGAGCCCGTCTCGA
GAGAGTATCAACAGGAACTCTACAACACAGTTTGCGAGCCGCTGCTTCTACGAGCCAACTTGCTTCTGAAGTTCGCTGCCGCATGTGTGTCTCATACATT
TGATGAGAGCTTGCCGGTCAAGAATCCAGAACAAGCAAACGTCGTTTTAGGTATCAATATTCCTCAATCAATCTTTCACTGCAAATTCTTGATGATTCTC
TTGTCGTAGAAGCTGGAACTCTATCACCCGAAACGGATTTAGATAACTTTTCGAATGAGTCAAAGTCTTCAGAAGAGGATGAACGCATACAAGCCGAGGT
CTTTTCCTTCTTACAACAATCCTGGACACAAGATTGCGTTTCCATGGACTCTGTCGACCCGGAATCCATCTCACTAGATGTTTCGCATCGAATGAAGCAA
CTTGTGTTGGACAAGAGAGAGCTCGCAGATAATCGTGTAGCTGGTTTACAGATATTTCACCAGCTTCTCATCAGTACAACCGACCCCAACGCTCGACAAT
TTATTATTTCGGCATTGGCTGTCGCCTTTAAACGCATCCAGTTGTCTAGCAAAAGTCCCGTATCTCATACGATATGTCCGCAAGCATTCATATCCCAGCA
AGATTGCTCTAGCAGGATCCAGAAGGTTCATTTTCTAGCTGATTTGGAGCTCATTGGAGGCTTACGATCTCAGAAAATCTCGGATGAGTTTTTCCAAATT
CTCTCCAGCTTGTTTGAAGCTTCCGTCAAACAGCTCGAAAGTCAATGCGTTCTCAGTACAGACAACAAAGAAGACAAAAATGCATCTCGAGGGTCTCAAC
TTTGCAAATTGCGTGGTGCCGTCCACGATATGCTTTCAGTTCTCGATTTGTGCAGCTTACCATATCGATCGGAAGATTGGAAAAATTTGGAGAAGATTGG
CATTTGCTCGCTGCTGAAGAAACTGGCAAATTGGGACACCTATGCAAAACAGCTCGATTTGGCATCAACCACCGATCTCGAAGACGATTCCAAGCACTCC
ATCACTTGTCCTTTGCTCTCGGCAGCCACAGGCGCGAGGTTATCAAAACTCATGTGTGGAAAGAACATTACTATTAAGACCGACCTGCATAAACTGACGC
TAGTGCACAGCCTGAAGGAAGGGAAAATTTCAGGAGGATTCGCAATTTGTAGTAACCCGTTCTCAAGAGGTCGATGGTTCTGGGAAGTATCTATCCAGTC
ACAGCACAAATCCCCCGTGTTTATCGGAGTTGCCACTTCGGCTTTAGACCTCAACTCATACAGCAACGAGAAGATTTTGGGTGAGAACAATTGTACAGGA
ATATACGCATTCCACGATTACTACATCTCATCCTCATCACACCACCGCAAGACCGAGATGATTTATCCAGTAGATGGACAAGGTTATGTCGCTGTCCAGG
TTGTGTTAGATTGTGGAGAAGGTCGGCTAGACTTTTACATGCGAGAAAAGCGATTCCAATCTCACTATTTGCATGATTTCCTGAATCAATCGATACCGGA
CTCGTATTACGCGGTGATTGGACTGGAAGATGCTCAAGTTGTATGGGATCTCGCTCATCCGATTCCAGCAAAACTCTGGGCAAACAGCATTGATTTTCGT
TTCAGATCTCCAGTGATTGCTGGAGACCTCATCGCTACTCCGTATCGTGGTCAAAAGTTGGGATGGAGCTCAATATGCAGCAAACATGTTGTGATCGCGG
GATCTGGAGACACCATCGTTGCTGGGTACGATCAGATGCCGGAAGAACTTTACGAGACCATTGTGCTGAGTCACAGTTTCAATGAGAGTGATTTATTCTA
CATGGAAATTTATCCTATATCTGGCGGCTTCGACTCGAGAATACATCTCACATTTGACATCGTCGGAAACGACTTTTTTCGTGAGCCTCCTCGTCTACTT
GGTGAAATTTCAAAGCATAAGCAATTGGCAGTCGATTGTTTGCTCTCCGAAGTCGACAAGAGAACTTGTCGATTTGGGGTTCTATTCGACTTTACGAGTG
GGAATATTACGCGTTATACAGCGGATGGAAAGGCTTGTGCGAGTGCTCAAATTGATCTTACTGGCCTGGGTTCAAGTTATAGACCCGCTCTCAGAGTATT
GCTGAATGGAGCCGTCATTTACACTGACACTCATCCGGCAATGGTTTACCCGAAAACGGCAAATATGGTCATAGAAAACGCCACATTGCACACCAGCCCA
ACGTCACGTGCAAGCAAAATCGATATACCAGCTGGTAAAGGGCTCGACATGAAGATATTCGAGTGCGACGGAGGAGAGACAAACACCTCACACATGGCCA
AGAACTGTCTCGTTGATGATGCAAGTGTGTTTAGCTCGAACAAAAGCAAAAATATTCATTTGATTCTGAAGCATCAGATCGATACACCTTTCTGTGTCAG
CTACCTTTCACTTCGAGGACCTGGTTCAGGATATACGCATCCAGCTCAGCATATCCTCGTCTTTATAACAAGTAAAACACCAGTTTATCAAGACTATGCC
GAATTTGATGACTTTACGCCGGAGCAATTTGCAGCTCTACCGTTCCCACCAGCCGCGTCTCGCCAATTTCGGCGTGATGAGCATCTTCCAGTAGCATATA
TCATTCTGGATGGGAGCTGTAGTCAGGTGAACAAGCCGTTGTTGTATCCAGTGTCGGGACGATTTATTGTGTGCAAACTCTTGACTGCAACAACAACGTC
CTTTACACGCTCGGCCATCGAAACCATTGATTTCGGATACATTGGAGTTTACGGGACTTTTGATGAAGAGAATGGGCCTGCATACAGCGATGAAACGACG
TTAGATTACTGTGACGAATGCAAACGATTATCTCAGATCGGTCTTACTTATAGCACGACCGGTACAGAAACGGCGACAATCTGTGCCTCATGCTTTGACG
ATTTCCGGGGAATCGCTAGCATTCACAATGATTATGAGATATTTGTTTCTGCTGAAAAGGGAGAGGAAGACAGCCCTTCAACTGCTTTAATGCCTCGTAA
AGTGTGGCATGCAAAAACGTCATCAATGTACGAAGCTCTGGAATCGATTCATGCAGCCTCGAGGTCAGCCACTTCGAAATCCAGCAGTCTACCAAACAAC
ACCTCTATCAGCCTTGAGCAAAAAGGGAAGGATTGCCAATGGTCTAGTACATCCTCACCAATGTTCGAAGAATGTGAGATTTTTTCATGCGGCCAAAACA
ATTATGGTGAGCTTTGTCTGGGTCACTGCAATCCAACCAATAAGCTGGAGCGCGCATCCTTTTTCTCGTACAAAAGCATCCAAAGTATCGCAGGAGGAAA
TGAAGTTCTTGTTGTGTTGATGAAAGATGGCGCAGTGTTTACCTGCGGCCTGAACAAGAGTGGACAGTGTGGAATTGGTAACTTTGACGAACGATTGATC
GTTCCAAGTCCAATTCCAGCCCTCAGCGGTATTCCAATCACGATGGTGGCTGCCTCGAATGGATGTGAACACATGCTTGCGATATCTCATGATGGTGCTG
TCTATTCTTGGGGATACAACGATCGAGGTCAGCTTGGTCTGGGCACAACAGTGTCCAAGAGTCATACCCCACGTGTGATTGAATCTTTACGTGAAAAGTA
TTTTATCACATTTGCTGCAGTGAGTTATCACCATAGTGCTGTGGTTTCAAACAATGGCGATCTCTTGACATTTGGAATGAATGATAGTGGCCAGCTCGGG
CTTGATCACACGCAACATCAGCATACTCCTCAACTAGTTGAGACACTCTCGAGCCAGAAAGTTGGCAGGGTAGCGTGTGGCTTGTACCACACCGTAGCTA
TCGTCGATGACGGAGACGTGTACTCGTTTGGGAAGAATGAATATGGCCAACTTGGTTTGTCTCACACTCAAAACACCAAAGTCCCAATGCTTGTCAAAAT
ACCACCCGCTCCTCGTACGCCAATGTTGGATGCGGTCAATAAGGCAGTCCAAGTCTATTGCGGGTATTATCACACTGTCACCATCTTGGAGTGCGGTAAA
GTGGTTACTTGGGGTCGAAATGATTATGGACAGCTTGGAATTGGCAGTAAGGAACACAAAAGTATCGCTCAATTTGTTCCTCTTCCACTCACGTCTCGAG
TCAAAAGAGCCTCTTGCGGGTGCTACCATACGTTGCTACTGCTCGTAAATGGACGTCCGATGGTGTTTGGTCGCAACAATAAAGGACAATTGGGTGTTGC
TTCACGCTCGTTGCCCTCCGCCGATTTGCCCCTGCCGATTCCATTGCATCCATTATCATCCGATGAAGTTGTCTATATCTCTGCTGGATTTTACTGCTCC
TACATTCTCACAGGGAAAGAAGCAAATGATCAACTCCAAGCGATGGGTGGCAATCCAACTGAAAATCCAGCTGAAGAAATGACAAGTCGTACTTGTAGAA
CGTCAGAAAAACTATTCCAAGATTTGATGAAGCAAATGGATCACTATTCTGAGTGTATGCAAAAGCTGACCGCACAAACATGCATCAGCGCATACCCGGT
CGTAGTTGCATCAAAAAATGTGACTTATAAATCAGGTCGAACGCTCGCTCTGGTTAAATTGTACAGCGCTTCATGGGCCCTTGTTCGAGGATTGATGCAT
CAATCTCTAAGCGGGGACAACGAGACAACAAGCAAGGTTATGACCACTCAGAATCCCGTGGTACGCTCTCTTCTGGACTTCTTGTTGGCCATTTTTCAGT
CATCAAGGTCTGCACAGCCGATCGCTTCAGAGACGCAATCATTGGTACGCTTTTTAGAACTCAAGTACGAAGACGAGAAGAGTGGCGTGAATAACTCTTG
TTTCTCGTTGCGGAACGCTTGTTTAGGGCTCACGAGATGTTTTCTAACACTCAAGAGCTTCCCAAGCCTCACAGGTCCAACTCAGGCGTTATGGCTTCGA
GAATTGTGTCCTCAATTACTCAACAATCAAGTATTATCACTTCTGCTCTGCTGTAGCTCAATGAATGACGAAATCTGCTCGGTACTGGCTGCCAACAATT
CTGTGATTGCACACACTTTAAGTAGCTTTGACTCGGATAATCTGACGACAGCGATGATCTCATTCCGTCTCGCGATGTTGCTATTCCCCTTCCATTCCGT
GGACAATATCAACACCGTATATCGAGAGCAAACTTCACGTCCGTCTGGCAATATATTGCGCACATTAATCCTTCTGGTTGGACGTCCATTGATCACCCGA
CCAAAGCTTTGTCATCATGAATTGGGTATTGAGTGCTGTATTACGCGAACTTGTGAAAAATCCTCCTGTATGAAAAAGGCTTGTCGTACCTGGAGTGAGA
AGATTCCGACTGCTTCAGAAGACCACGCATTGGAACGTTTATTAGATCGCTATCACGTCGCTCTTGCAAAGTCTGATGAGTCTCTTGCTTTACTTCGTTA
TATGACGATGTTCTCTTCGTGGAAAGCAGCCGTGAACGATACGATGACCTTGGCCTTGCAGAAACAAACAAAAATTAATGATATGGCTCAGTCCATAGCC
ACTTACTACACGCGACTTCAAGAGGACTCGGCCGGATGTGATACTTTTGTCCGCAAAGATGAGGGTGAAGATGCATTACGTCAAGCTGAAATCACAAAAG
TCAGCAGTCATGCTCCAGGTGTATTTTCGTTGTCGTCCGACGCTTCCGCTAGTGAGAGGGTCAGCGAGAATGTCAGTCCTGATGAAAAAGAAGTTCTTAA
CTTCTTCATAAAGGCCCGGGAATCTCTCGACGACATTGCATGTATTATGGCTGCAGTTGCAATCTTTGGTGGTCACTCCGAGTCTCTTCGTGAAGGATGT
GCTGTCATCTCACCAGCCAAAGAAGTCGACAATTCTGAAAGATTTGTAGGAACATTAAGCAACGTGACATTGGACAAGAGCACATTCGAGCCCATGGCTA
CTATCTTGCTGTCTGAGCCCAGCACAAGTAAGCGAAAACCCGAGATTGGCAAGACAACGCGTCACTATTTCGACAACGATGGAGCGGGGACCTTCAACTT
GTTCACGATGAGCAACGCAAGAAGTACTCCAAGACAAATCAGTCTTCCGCTGAAGCAATTACGAGCTCTGGAGAAAGTTCCACCCATGTTTTTAATGTGC
AATGATGTGCAATCAGTGATTTCGGTCTTATCGTCACTCAGCACTTTTCAGTTCAAAGATCACATGATTGATGAAGCAAGTATCTTTAGAATGCCCACCC
ATCAACCAGGGCACTTCGATGTGCTTGCTGCCATATATGGGGATTTCTTTGAGTCTGTACAAAATCAATTGCACTGGAGGTCGACTAAAGCCTTGTACAC
AATATACAAGCAGATGTCCTTCCCGAGCCCGAGTGAAGAGCTTACAACACCGATGACCGAACTGCTCAACAAGCAGATCATAAGTACTCTTGCTGCCATC
ATCAACGATGAAAGTCTATTGCTAGGATCCAATAGTAATTGTGACACAAACGATAGTCTCGATACATGCTGGCAAAGCTCTCAGTCCAAGGATCGTCTTA
ATGATCGCTGGCTCAATACGCAAATCAGAAAAGTCTACTTGGGTGCTCAGAGCGCTTTGGATTCTACAATTGATCATCACGAGACTAAAGTGCGAGCTGC
AGTTATCAAAAAGATGGAAGATGAGAACGAGCTGAGCTGGGGGCTGGATGCACTTCAATCGCCTAAAAAGGAATATGATCCCGCAGTCAGAAGCGGAAAA
CCTCTGGTGCAGCACCAAATCTTGTCTGTGGATGCCCCTACGTCGGAGCAAGTGGATCAAGCAGCGGCAAATACGAGGACTTCCATTCCAAGTGAAGCGT
GGGGAGTATTATATCCTCTTCCAGTCCTACAAGACACAGACGGAAGCACACCAGATGAAACCCCACTGAACACAGCTCCATTCCCACTAGTGACATCGGT
AGTTCGAGTGGGACGCGCACCTGATTCATGTGATATGGTAGTCAATGACAGAAGCGTAAGTGGAAGGCATTTTCACCTTCGACGCATCCATGGAAATGAT
GGTGAACAGTGTTTCGAACTACAAGACTTTAGCAAGAATGGAAGCATAGTCAATGGAGTACGAGTTCATGGTACGAGCACCCGAATCAGTCCGGGATCTC
GTATATCTATAATACTATCCCGTGGCGGCCTGGCAAGCTTTGAATTCCAAGTTCGGGAAACCGATCACACCGGTCATTTATCTATAGCCGATTCAGGAAG
TCGCTTATCGTTATCCAACCCACTCTTTCAGCGTATGCCACCTCCGACATTGGTGACCTCGGGTAGACAGTCAACTGTTCACGGTGTTGGCAACAGTAGC
AGTGAACTTCAGCACTCGGTAGGCACTGAAACGACCGCGGAATTTGATGGTAATCCATCTTCTTCAGTCGAACCAAGAAGCCCTGCCCAATTACAGAATC
GTGGGGCTAACGAAACTATCACACAAGCTGCAACAGATGGAGCACGTGTTGGTGCAAGAAGACAAAGTCTCAACCGAATAGATGCTTTCAGAAGTAGGTT
CACTTCACAAGGACTGAGGCTGATAACCTCTGTCACGGAGAGTGATGTCCCCCGTGCATTGGTCTCTCCGAATCCAGCAATTGATTCACCCAGGCTAAGT
AGCTTCAACTCGCCCCGCTCGTCTATTTTTCAGATGCCAGGAACTCCTTCTTTCGGTTCACCTACGGGAAGCACTTGTATTAGTACACCAACACTCCATG
GAATCCTTTCGCCAGCTTCTTACCAGCAGCACGAGAGCTCAGCTGCATATGACACAACTGTAAACCTCCCACCAGCTTCCAGTAGCTGCAGCGAGGAAGC
GATGATAAATGAGGCTTTACGGATGGTTTTGGGAAGAGAGAATCTACCACGAGAAAAGGTTCACGAAGTCGCCAAATCTCGAATCCCATACCTCGGTAGA
CTGCGAACAATGCTTCCCATGTCACTAGGCAATAGCGACACAGCAAACACATCAAGTGCTGGCAAGGAGAAGAGCCAGATTGATTACACTTCACGCGCTG
TCGATTTAAGGTCGCGTGTGCAGGACCACTATGGATATCAAGTTGCCATCGAGTATTGTGAGGAAGCTCTAGTCTGCTCAAACGGAGACTTGAGCGCTGC
TTTTCTCCGATTGCAAAGTGCGATCGAGGAAGTCACATCCCGACAAAAAACCATCACACCCTTCTCATCCAACGCCTTCCACCTAGCTCAACTTTTGAAT
AGGGATGAGTTTACCTGCACAGAGGCACTGCTTGCGGCTGGTAATAACCTCAGAGACGCGCTCCGTCTACTTCTAAAGCAAGACGCAACACCTGTGAGGC
ATCCTGCTGAACTCAGCATCGTAGAACTCAACAACTCTACAATCAACAGATCATCAACGGATGATAACTATTTGAGATACCAGGAGTCAACGGAAGAGAA
TCCTTCGTATGCTCTGGCCGAATCGTGCAATCCGGCTGGTACCGATGCATCGGAGCCCGCACCAATACATCGATGGACACCAAACACAAGAGATCCTTGC
AGACAATCAAAAGAGAATTTACCTGTCAAGTTTTGGACTTGGTTGCAATGCAATACTCAGTCAGATGGAGGAATCGACAAGACGAGCTATTACGAGTCAC
ACATTGAGGAAATCAAAACAGGAAACTTCATGACGGCTGTCTATGCACGCAAGACTCTGCTACATCTGTTGAGGCAATGTGAGGCTTTGGGAAGCAATCT
CGAGAAAGACGTATTTGCTTCGTTTTCGGCAGCCTTACTTCGTCGACTGGTTTTGTCGATGCGAGAAGAACCGGAAAAACGAAAAGGTGAAGTCAAGCTG
CAAACCTTGCAGGTGGTGCTGAAAAGGATGATCTCGGAAACTTTTATAACAGCTCGTGGAGGCAACGCTATGGTCTCCATACTGAGACAATCGCAAGCAA
TCTCTATTTTGATGTCGGAGATCGATAATTGTGATCCAAGATCGTCCATTACAAAGTCATTCATGATGCGAATGTTTTCATCTCTCCGAGTGATGGAAGA
GAAAGGAACGAAAGAAGACACAACAGCCAGTATATTGAAGGACGAAACAGGCCCAATATCAGAGCATTTATTCATCGACGCAATTCTTCATATTCTTTCG
AGGAGCTACTGTGATTCCAATCCTACCATGTTATGGGATCCAACCGGAGCTAATATTTCTCTGCAAAGAGAGCCAATTTATTGGAAAGGACCACTCACTC
TCTCATGTGGATTGGATGTCGTTGTGGTCAATACACTTGAACGATTGTGGAGCTTAGCAGCTCCTGATCCATTACTTCAGTATCGCCATAAATGGAGAAA
TCAGAAGAATAGGAAGAAATCGGACGATCTGATCTGGATGAAGCCGGCTCACGATAGTCATTTGACATTGTGGAGACCTGTTCTTCCGTTTGACTTGACG
GCACTATCGTCCGCTGGAAGCAAACACCGGCATAAAACCACCGGACAGTACCTGTTGGAGGATGAGAACAACTGGTTCAGTCTTGGAGACATCCTCACAT
GTACTTATGAAGTTGGTGAGGCATCACCCAAGATAGCAGCGCTGCTCGTGTACGACCATCATGAAGGCTTACTAGCCCCGCCGGTTGGCTTCCAACGCAT
CGATGTCACTGGAAAAGGGCTGCCTTTGTGTACATCTGAGACAAACTCTGAATTGTATAAGAAGCAACAACGTTCAATATGGTGGCCAATTGCACCTCCT
GGGTACATATCACTAGGTTGTGTCGCTGGCACGAAGCAGGAACCGCTCATGTGTCCGAGTAGGGATTCAGTGCGATGTGTGAGGCAAGATCTTGTCTTAC
GGACAGCAAAGGCTCATTCCGTATATCACTCCAAGCAAAGTCATGAAGACGGATCCGACGAAGATGAAGAATACAGAACCAGCTTGTTGGTCACTCATGA
AGATTTTGTTGGTGGGACAGTGTTTCCATCAGCTATGATGACTGACGACTCAAAGGAGCATGAAACCGCCGTGTTTCATTTGAGCGAGGAAGACAAAATT
ATCTGTGGTCCTGTGACTGTCAAATCGGTCTTACAATTCGTCAAAGCTTATGTGTGCTGCAAGAATTCTGAAATCAACACTCACGAAGTGCAGACAGATG
AGACGCCGTCGGCTCTGGCTCAATCCTTATTTATCTTGTTGAAACAAGTTATTGCTGAGGCAAACCCGACTTCAGCTACGATTGCAGTTTGTGTTGTTCG
AGCAATGATATCGGTGATTAGAAAAGGTGAGCACTGGAACGATAAAGCTGGTCTCTTGTTTTGCCGATCAAAGATCATGAGGCTATATCAAGAGCAAGAA
AACGGACTGATGGTCAACTCTCTGTGTCAGGCTTTGATCGAGTTACTTCTGACCGTGCAAGATCACAATCGTGCAACGGAAGTGGAAAGGCTGAAAGCGT
GCACTCAATATTGCTCCAACTTGACGTCTCCATACAGATTCCAATTCTCTCGGCAGGTGACGAACGAAATGCTAGTCAGCCACTCGTCCAAGATTTTGGT
AACAAGGTATGCTGGCGAGGATGAGCGCAAGTTCCTACTAGAGTATCATCCAGAGCATCCACCTAGCGACAAGAAGATCAATTATAACCTGGAAGAGGAC
TGTCATTCGTGTCGATTTGAAAATACGCCCGAACTGCGAGTATTCATGCATGGAGATGTGAAGGCGGAGATTGTATATTACGAGCTGACCATCATGGAAT
GGAAGGATGGCAGCGTGTTTACAGATGGAAATGAAAAGAGTGCCCATGGCTTCCCTGTGTTTGCTCTCGGCTTCTCAGCAGTCGACTATGCTCTTGAAGG
TCCATGCATCGGTATGAAAAATTGCTTCACAGCGGATGCTACGACACCATCTCGCTCTTACAGTTTTCTTCCTTTTAACTCCACCATCCACACGTCAGAC
CCTCATGCAGATCAATCCAGATGGAATGATCAGGTACCCCCTTCCATCACTACGGGCGACAACTTTGGCTGTGGTATTCGCCTTGATTCGCAGGAGATTT
TTTTCACCAAGAATGGGTATCTACTTGGAACGACCTTTTTCTCCGTGGATCATCCATCTGCATTGCATCCCACCATTTCTTGTAGCACCGATTGTAAGCT
GCTCATCAATTTTGGGTCATTGAACCATCAGACTTCCATTCCCACCGAGCCTGAAACAGGCTTGACTGAAGTCTCATCAGCCACAGTCGAGAACACCTGT
ATGGATTCAAATATCCAGATTCCCATGAATTTTCATTTCCGATTCGGATCGATGGATTTTGAAAACCTGATGGCTGCATTCGAATGGTTTGAGCCCATCA
ATCAGGTCTACGGAATAATGAAAGCAATGTTGGCCTCGAATTTGGAAGAATGTCACACGACGGACTCTCAACACAACTTGAAGCCGCTAGACAGTGGACT
AGTGAAGCAACTACCTGACGAGTTTATGTTGTCAGCAGACACTTTCCTTGCAGAAGTAGCCGAAGATGTTTGTCTTCGAGTGGAAAGCAAGCATCCCTAT
GACCTTGAACTCCAGGAAGCGTTTGTCAACATCCCGTTGGCATGTTCTATACGCGTTCGACTAAGTCCTTCATGTCAGACTGATCCTTCGCATTGTCTCC
AAATTCTACAAGGTGGTGATACATCTTCAGAGTCAGATCTTGATGGTAGAGTTGTTCACACAGGTGCAACAAGCGTAGAGTCGGAAGTTCGCGCATTTAC
CGGAGCTTGTGGGGGTCAGGAAGTCATGATCGAAGGCGATCGATTTATCTGGCGATTTCCAGTACAATCAAACTTTCAAAGTCGCGTCGACCGTGTGAGA
AAAGGCCCCTACCTGAGACTCGAGAATCGTGACACAAGATTATCGCTTACACGAGACAAAGGATGGCAAACGGCGATCGGTGTGGCGAGGTTCGATAGCG
GTGTGCATATTTGGGAAATACGTATTGCATTCGTCACTGCAAGCTCCAACATCTTCCTAGGAATCGCTCGCAAAGATGTGAGGCTGGATTCTTACCTTGG
GAAAGATAACCGAGGCTGGGGATGGATAGGAAATCGAGCGCTCTGGCATAACGGGAGTAAACAACGTGGGACCTATGGAGAGAAATTTAAAAGTGGAGAT
TTAGTAAGGATGACACTCGATCTGAAACGAGGAACACTATCTTATGCAGTGAATGGGAAAGACTTGGGCATCGCTTTTGGCCCGGGAGGATTAGGCTCAA
GGCTCGAAGGAGTATTTTATCCAGGCTTTGCACTCTACAACCAACGCGATTGTATCGATTTGAGCGGTGGCCATCGTGTGGATGATGGGCATGAGCTTGC
TAGAACTCCTGGTCCTGGAATGACTGAAAACACGCTGGAAGAAGAGGATGCAGAATATTATAGTGATGAGGAGGATCATCTTGACAATGAAGATTCCAGT
TTGCGACTGGAATCAGCGGCAGCATTGACTCAAATGGGATTCCCATTAGATTGGTGTATCTACGCTCTTCGTCAACGTGATGATGATGTCGAGCAAGCCG
CTGACTTTTTACTCTCAAATCTTCACGTGATGGATGGAATCATTAACGAGGAAATGGAAGAACAACGTCGCCATCAAATTCGGCCTAATGACCGAGTGAA
TCGCGATATTGGTGTTTCAGGTGTAGGTAATCCGTCAGTCAGGGGGTTTGATTCGCAAAACGCCGGCTCCGACGCTGAGGTCGTGGGAGAAGAAGAAAAC
ACAGATTCTGAGATTTGGGGGATCGCATTCACGGCTGTGCCAGAGTTCTCACTCACTGGGCGTCGAATTTTAGCATCCCGATACGCACAGAAATTACAAC
AACTTCATTCGGACCAATCTGTATTTACGCTCGAACACGATGAAGCGATCACTCGAATTGTGAACGAGGTTTGCGAGAGCCGAGCAGAAGGGCTTCTTAG
TTGTGATCCTTTACGTATGACCCCAGAGGAGTTTTCTCCAACTAATGAGCATCTCCGAAAATTCCGTTGCCTGGAGTCGGTACCCTTATGTCAGCTTCAG
AAGCGATTCCTCATTTTACGCAATTTCAACAGCAGACTGCAGACATCGCTCTCATTTGTTGACTTTGTAGCAGAGTCGGAGAGCTCAGTACTGGCAAGAG
GCATTCATTTTCTACGTGGGATCATTTTCCAGCATGTTAAGCTAACGTGGTGGCTTGGAGTTTTACGAGAGCAACAAGCCCCGGTTTCAGCAAGACCAGA
AATCGAGATTGACCGACATCGAACCTTCGACTCAACCGAGCAATCCGACATCAAAGACACAGTGTTCGATCAAGCTTTTGCACAGCTTCATTACATCCAG
CCTTCTCTGTTGCGTGGTTCAGATCGAGCGTTCAAATGTCAGTTTGCAGGCGAATTTGGTGATGACTTTGGAGGGTTATATCGTGAATGCCTGGCACAGA
TAAGCTGCGAGTTGCAATCGAAAGCTTTGCCGCTATTCCAACCATGCCCCAATGCTCACAATGCCACGGGAGAGAATCGAGAGCAATTTGTACCAAATGT
ACAGGCGAGAAGCGACAATCGAAACGTTGAAATGTATGAATTTCTTGGAAAATTGATAGGGATTGCCATCCGCACAAAAACGCCTCTGGATCTGAATCTG
CCAACAGTGGTCTGGAAATTGCTCGTAGGAGAACCAGTTTGTCGAAACGACATTGAGCAGATCCATCGAGGCTGTTTTAAGGTACAAAGGGTACTGCACT
CCTTCTTGTGAGGGGTCTGATTTTGTATCTACTTTAGATTGTCGACACGATTCAAAACATCGAAAATCATGGTATCACCGAGAGCATGTTTGATGAGATA
GTTGATACAAACTTCACGGTGATGTCAAGTACGAACGAAGTCGTTGAGCTCGTTACCGGAGGCGAAGATGTACGAGTGACATGGCAAGACAAGGAAATCT
ACGCTCGTGCTGTAGAGAATCATCGTTTGAATGAATTCCGTTCATGCTGTGAAGACATCTTACGTGGAATTGCGACCATTCTGCCGGCCAACACACTGTC
CTTATTCACGTGGAAAGAGTTCTCCACGCTCGTATGTGGCAAAGCTACAGTTGATATCGACCTACTCCAAAAGCGTACTGTTTATGGAGACGGCTGCCAA
GCGAAGGATCCCCATATCGCCTACTTTTGGCAGATTCTGAGCGAGTTTACGGATGAGCAAAAGTCCTCATTTCTTCGATTTGTTTGGTATGTTCTGCTCG
GACCGCTAATGTCCTTCTCTGACAATCTGAATCTTATTATAGGGGACGATCTCGCTTACCAACTCACGCAGCCGATTTCACACAGGATTTCAAGATATCA
GGTCTTCCGAAGGCGGCTATGAAACCCGACGCATACCTCCCGGTCGCACATACATGTAAGTGCCCTAGCGATTACACCTGTACGCTCTGGCTAATGGAGA
AATTGATGATGTAGGCTTCTTCTCAGTGGATTTACCAGCGTACACCTCGAAAAAAGTGATGAACGAGAAACTTTTGTACGCAATCACACATTGCCAATCC
ATTGATGCGGATAATACGACGCTAGCTCAACGTGCCGGTCAAGGGATCAACTGGACAAACTTGAATGCGGCCACTGCAGC