Description :
From Genome Similarity Track
Location :
contig_1:305119- 306681
Transcript NameFunction/comments
g107.t1hypothetical protein

Sequence
1562 bases(100 bases per row)
CGAACAGCGCCAAACGAGCTTCAAGCTGACGGGGAAGCGCAAGCACCGGCCAAGTGGAGAGGACGATACTGCCAGGAGATCGCGCTCCGTTTGCCACAGA
GCTGGCTTCGAAGAAGCAAGTGCTCCAGACGTATCCTCCTCGCACCGAGCCGAACCCGATGAAGAAGAAAAGTCTGGAGACCAAGATGAAGATGAAGACT
CGACACCTCCAGTGTTTCGGAGTACCTGTGGTATCCCAGTGATGACAAGGTTCAGGCTTGCTTGCACCGTCGGAACCAAATACACCCAGGCCTTGTAGCT
CATTTGGTAGGTCAAAAATACCGCTCGGATGACTTGTAAAATATCACGATTCACCCGCTCTACCGATACATTTATCCATGAACTGTAGGCTGGCATAAAC
TTCTGCTGCGTACACAGCCGACGCCTCAACTCTGCCACCACTTCATTTTTTCCATTTTCCGACACCCACTGTGGCGGTATCCCAAACCACGAGTGCCAAG
CCAACAAAGCTTCTGCTATCTGCCGTATCCGCTAATTCACAGTAGTGTGTAGCATGGTCCTTCAGTACAAGTAGGACCTTGCTGACTTCATAGCTTGCTC
CCATATAGAGAAAATCAAAGCTGAAAACTTCATTGCGTATTTCACAGTAGATCACTTCGCCCCAGGGTCGGGGGATAATCCTCTCTTCGACAATGCAAAC
ACAGCAAACAATCATTCTCAAAGTTCGCGATCATGGACTTACTGCCTACGGTGGCCTTGCCCCCCCCCTCCCCACCACCACAGTGTGCCACAATACACAG
CCTCTGAATCAGCTCGGTTTCATCCGCCGGCACCCAAATCCGTCCCACGATCTTGATCGTGCCCTCTACAGTGGTTTCTGCTTCCCCTGGTGCTTGATAT
TGTCTTTGGACCATCGTTAGTTCCTCGAGCGTAGGTCAGACGAAATTTGTCTCATCGAGAGATGGCAGTCGTGGCCTGCTCAACGTCGGTTGGCGACGCA
CTACCTTAATCCGTTTCACTGTTGCTACCGGGGCATGGCTCCCAGCCCAGCGAGGATCATGTCGGCCCAGACGTTGTCAGGAACAGGTTTGTGTTCCACC
ACAATAAATACATTAGCTTCATCGCCCACCTGAGCAACTTGCCTTTGTGTGTTTCTTTACAATTTCATGCAGCACTAATACGTGAATCAAATACCTGTGA
TCACAGAATACTTGAAATCGTTGTGATCGCAACAATAGGTAATCCATCTTCTCACATGCCAGTACAATCGGCAGGGTCTCCTTCTCAATCACAGTCCAGT
TCAACTGCCTTCCCCATGAAAGCCCTGGGTGAGTTGGTGTTGCTGCTCGGTGGCTGGTCGCTTCTGGTCCTACTCTTTGACTTGACCGATGGTCGCGGCC
CAGCCAACGTCCTACGCATCCTTGAATTCATGTCGTGGCGTTACCATCGGGGAAGGCGAGTGTTGCAGTGGCTGCCAACATCTTCTTCACCGTGTCGAAA
GCTTCTTGCTCCTCCTTGCTCAACTCGCTCTCGATCTCAGTCGCAGCACGTCGTGTGCTTAT