Description :
From Genome Similarity Track
Location :
contig_1:305102- 306664
Transcript NameFunction/comments
g91.t1hypothetical protein

Sequence
1562 bases(100 bases per row)
GACCATTGGACTTTCGGCGGATCCCTCAGATGAAAACGTCAATGATTCTGCGCTGGAACTCGACGCTCTCGACCTCGACGACAACGAACAGCGCCAAACG
AGCTTCAAGCTGACGGGGAAGCGCAAGCACCGGCCAAGTGGAGAGGACGATACTGCCAGGAGATCGCGCTCCGTTTGCCACAGAGCTGGCTTCGAAGAAG
CAAGTGCTCCAGACGTATCCTCCTCGCACCGAGCCGAACCCGATGAAGAAGAAAAGTCTGGAGACCAAGATGAAGATGAAGACTCGACACCTCCAGTGTT
TCGGAGTACCTGTGGTATCCCAGTGATGACAAGGTTCAGGCTTGCTTGCACCGTCGGAACCAAATACACCCAGGCCTTGTAGCTCATTTGGTAGGTCAAA
AATACCGCTCGGATGACTTGTAAAATATCACGATTCACCCGCTCTACCGATACATTTATCCATGAACTGTAGGCTGGCATAAACTTCTGCTGCGTACACA
GCCGACGCCTCAACTCTGCCACCACTTCATTTTTTCCATTTTCCGACACCCACTGTGGCGGTATCCCAAACCACGAGTGCCAAGCCAACAAAGCTTCTGC
TATCTGCCGTATCCGCTAATTCACAGTAGTGTGTAGCATGGTCCTTCAGTACAAGTAGGACCTTGCTGACTTCATAGCTTGCTCCCATATAGAGAAAATC
AAAGCTGAAAACTTCATTGCGTGTTTCACAGTAGATCACTTCGCCCCAGGGTCGGGGGATAATCCTCTCTTCGACAATGCAAACACAGCAAACAATCATT
CTCAAAGTTCGCGATCATGGACTTACTGCCTACGGTGGCCTTGCCCCCCCCCTCCCCACCACCACAGTGTGCCACAATACACAGCCTCTGAATCAGCTCG
GTTTCATCCGCCGGCACCCAAATCCGTCCCACGATCTTGATCGTGCCCTCTACAGTGGTTTCTGCTTCCCCTGGTGCTTGATATTGTCTTTGGACCATCG
TTAGTTCCTCGAGCGTAGGTCAGACGAAATTTGTCTCATCGAGAGATGGCAGTCGTGGCCTGCTCAACGTCGGTTGGCGACGCACTACCTTAATCCGTTT
CACTGTTGCTACCGGGGCATGGCTCCCAGCCCAGCGAGGATCATGTCGGCCCAGACGTTGTCAGGAACAGGTTTGTGTTCCACCACAATAAATACATTAG
CTTCATCGCCCACCTGAGCAACTTGCCTTTGTGTGTTTCTTTACAATTTCATGCAGCACTAATACGTGAATCAAATTCCTGTGATCACAGAATACTTGAA
ATCGTTGTGATCGCAACAATAGGTAATCCATCTTCTCACATGCCAGTACAATCGGCAGGGTCTCCTTCTCAATCACAGTCCAGTTCAACTGCCTTCCCCA
TGAAAGCCCTGGGTGAGTTGGTGTTGCTGCTCGGTGGCTGGTCGCTTCTGGTCCTACTCTTTGACTTGACCGATGGTCGCGGCCCAGCCAACGTCCTACG
CATCCTTGAATTCATGTCGTGGCGTTACCATCGGGGAAGGCGAGTGTTGCAGTGGCTGCCAA