Description :
From Genome Similarity Track
Location :
Scaffold_2125:3051- 5052
Transcript NameFunction/comments
Phyta_totarag14133hypothetical protein
Phyta_totarag14134hypothetical protein PHYSODRAFT_330603

Sequence
2001 bases(100 bases per row)
CCGACGCGGACANGAAGAAGTAGATCAACGATCCAGCGAGCGTGATCTTGAGTCTGGTACGTCCGTCCGCCGTGTATAGGGATTTTCCAACACCTTCACA
TTCCAGTGTCTAACTTTCGTTAATGTAGCACCCAACCTTACGAGCAAATGCGGTGTCAATAATAGACACCTCGGCACCACTGTCAAACAACATGGTTGCT
TTTTCGTTGTTGATTTTCCCCACAGCTTTCGCTTGTTTGAACTTCTTGTCAGGCACGTGGTACTGCCAGTATCTACGCGATTCTCCTGGCGAAATGTCTA
AGGCCATCGTCACACTTGATCGCGAATACTCGTCGATCTTGTGCAAACTTGACACAGCAGCGGTAGGTGTTCCATGAAGATCACATGTATTGTCGATCGG
ATTCATCAGCTTGCTAACCATCGACTCCGATTGTTTCTCGACATATGCATAGACGCAGTATCTAGAACGCTCGTCTCGCACCGGGTTCAAAACCGGCGAG
CGTCCTAGTTTAACatcttctccgccgtctccggCAGCATGCCTGCGTGCTTGGTGGGGTTGAACCACTGACGGATTAAGTTGTAAAACTCTTCTATCGG
GCATTGGTCAGCGTCGTGGATCTCACCGCAGGCCTTGCACACAAAGAAGCATCGGTCGGATGAATGCCCCTTTCGGCCACACTTCTCGCAGGTCAAGCGT
CCCCAGCATCCAAGATCGGCATGCTTGCCCGACCCGCAGTGTGAGCAGCGCTTGAACGTTGTTACCAGGTCAGTCGATCTGGTGTGTCGATCTTGCTGGT
GGTTCTGGCTCGTGTGGTCTGTGTGGTCACTGTCTTGATCCGGTGGCCCACGATCTTGTGGCTCGCCATGATTTTCAGCTGCCGTCAGGTACACTCTGCG
CAGTCCCGCTTCGCCGTCCGATCCGCTCGACTCCGCTTCCGATTCACTACTGTCGTCTGCCACGTGGATCGCGTGAAATGCTCGCGTGGTAGTCGACGGT
GTGGCTGCGGCCGGTGCTCTTGTCCGGGGCTTGATCGATCCATAGACGTTCTTGCGCTGACGTGCCTTCGCACGCTGTCGAGATCGAAGCGTTTCTTCCA
GGGTATCGGCATCTGGGATTCGCAGCAGGGCGAGGTGGTCGGCGAGGTCACAATCATCTAGCGTGGTCGACGTGTTCGCGTCGGGTCTCTGGAGATCCAT
CCTTCACTTGGAGACGTGCACGGAGCCCAGCTACGTTGAGACGATGCAGATATTCCAGCGGTGACTCGTCCGATCGCTTCCGCGCGTGGTAGTACTGTCT
CGCGACAGATACGCCACGGCCGCAGTACTGCGTCTGGAAACTCAACAGCAGATCTTTCCAAGTGCTGCGAGTCGTGCGGCTCAACTGCCGGTACCAGTTC
CGCGCTGACTCAGTAAGAAGATCCCCGAAGACCAGGCACTTCTCATCACCAggcgcttgatctcggatGAACGCTGATTTCACTTTGCCGATCCAGGACC
GGGCTCAATCTTCGTCGCCCTCCTTTCCCGTGAACTCCTTCAGTTCAGACATTGCTGACACGCGGATGGGTGGGGTGGCCGTCGATCTTCCGGCCTGTGA
AGTTACTGTCGCTACCACTGCTGCGCGAGTAGTCGTGGTAAGATCAAGGTCGTCGAAATCGTATTCCCATGGAGAGGAGTGGTGATCTGGCGATCCAACC
GACTCCATCTTCacgtcttgatctccagtcggTCTCGCGACACGTGGGCGGGGAGTGGGCTGTTGTTCCTTCAGGAAGCGTCCCATCGCAGCCTGAAAAT
ACGACTCCAGCCTCTCTGGTGAGTGGCGTGTCGGGTTCATTGCTGCGATCTTCGTCTCTTGGGCCGAAGCTACTGCTTCGCGCTCAGTTCGGTCAGCTCG
ATCTCGCAGCATGGCGGCGCCGGATGGTCCAGCGTCATTCGCGGCGGGtcatcgacgctgtcggAGTCTACTTCTTCAGTCGCCGACGCGTAGTGCGACG
A