Description :
From Genome Similarity Track
Location :
Scaffold_29:30505- 32345
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_29-abinit-gene-0.100Gene trap locus 3

Sequence
1840 bases(100 bases per row)
TTCCAGCTTCCAAAGCTAGCAGACTTACTCATCGACAGCTCCACTCGCTCCGCGGCCTTGCGGCACAAGCACCTGGACGAAGCCAAGAAAATCGAGCTGC
TCATCGGGAACAACTGCGGCAGGCGGATCAGCTCCGTGTCCACGAACCTGCCGCCATCGATCCGCAGGCGACTGCAAGTTTCCGTCAGGGCTGAGCAGCG
CCGTGAGCAACTCTACTCGGTTCTGCGCCAAGACTACCAAGAGCTCTGTCATCATCAGTAGCAGGCAGCTGGCAGGTGGGATTTTCGACCAAGTGTCTGT
CGTTAAATTACATTCTTTCTCTTTACATCTCCAGCAGAAACGCGTCCTCTGGGAACCCGTCGAAGAGGCTACTAGCAATCGCGTCGTCAAAGAGCGAGCT
CTCGGGGAATGGGTTCGCCTGAGGGTCTTGCTGTTGCTGTTGCTGCGGTTGAGGCACTCCGAGCGTCTGAGCTACACCAGCTCCTGGATTCTGGAACTGC
ATGTTCGCATTCTGCGCTTGCTGCTGTTGCTGAGGTTGCAGTTGTTGCTGTTGTGAATGCTGAGGTACCTGCTGCTGTTGCTGTTGCTGTTGCTGCTGTT
GTTGCTGTTGTTGTGGCATACTCATTCCATACGGGAATGCGTTCATCATCATCTGCTCGGGCATCATCGGAAACGTGTTCATTTGATTCATCATCGCAGC
CGACTGCATCCCTGCCATCGCGTCAAATCCACCCGTGACGGGATTGAACTGCGGTTGACCAGGAAATACCGGCTGGTTGAAAGATGTGTTGAACGGATCT
GCCGGCAGTTGATTGCTGTTCATGGTGCCGTAGCTGTTGTTGAACATCGCGTTCGAGTTGTACATACCCGCTGCCGCCATATTCATCGGCATCTGGCTTT
GCATTTGCATCTGCATCGCGAGATACTGTGGGTTCATCATCGCCATGCTCATCGCCGCCGCAGGGTTCATCATGTAGTTTTGTTGGTTCAAGAACACCGC
GGGGTCCCCAGTATTCATGTAGGAGTTGGCCGCGAATGACTGCGTACCGCTCATCGGGAACGCCTGCGCAGACGAAAGTGTAGCGTTCGAGCCAAGGGAC
GCGTCGCTGAATCCCGTCGACGCCATCGCCCCACTCTGATTCGAGCCGTAAAACGCCCCACTTCCAGAAGCTGTTGGGTAGCCAAATTGCTGCGGATTGA
CGGGGTTCACCATGGGCATCGGTGGTTCTGGAAAGGAGATCAGCGATGGGATTGGCGCAGCTGGCGTCGCGAGCTGCACGTTACTGTTGTCTATTGCTGT
TGCAGCAGTAGCAGTAGCACGCGGAGCTGGTGCTGACGATGACGCTGACGCTGATGCTGATGCTGACGCTGGTGCTGCGGCTTGTTGCTTGAGCTTGTTC
TGCGCAGCTTGCCGTGCGAGAGCCGCCGACGCCTTCGACTTCTTCGCTGTGGTCTGGGTCACCACGGGCGGCGTCGCTCGCTTCTCCGTCGCGCCTTTCT
TCGCGCGGTCCGAGCTCTCGTCCTCGACCGCGATCTGTTTGTCTGCGAGCGACGCCAGCACTTCCAGCCGCGCGCCGACTTGCTGCCGGTATGTCATGCA
CTTGCGAATCCACTCTTTGTGCTCTTTCACCAGCGTCTTTGGCGCTGCGCAACACAACAAGCCGCACATAGAGATGATGAGCACATGATACACACACAAT
GTGTACTACGCTGCTATAACAAATGCATAGACGTACGCTCTTGTGTGTGCAGCACGTTCCACCCGCGCAGCGCCGCGTCGTTCTTCTCGAGCATCGCCTG
AATCTCGCGCGACGAAATCTTGCGCTCCGCCGACAGAAAC