Description :
From Genome Similarity Track
Location :
Scaffold_19:3050- 8184
Transcript NameFunction/comments
Hyaar_Emoy2803254hypothetical protein

Sequence
5134 bases(100 bases per row)
TCCTCTGACTTAAGGAGCTGTGCAGCCCCGCTACACTTGGTAGCACTTGTAGTCAATCTACGCCTCGGTCTTTAAAGACTGATCCTATGTGAGGATGGAA
AATCCCACTCCCTTTTCTGATGCCCAAAAGGTCGCGCTTGATAAAATGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATCGCAAGGCCCGG
AAGTGCTGACTGCACGTGTTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTCGGTTATGCCTGCACGATATGT
GTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTTAAAACTACTCAGGAAAGGAGGGTGAAAACCTCATCCTCTGGATCCGTGAGA
TTGAGATGGCCATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTAAAAGAGCTAGAGAATGGGCCTTGACGTGTAGCACGT
CGGTCGACTTAGCGTTTCCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTACCGCGTGCGTTCACGCTTTTT
ATCAACCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGTTGAGAACTCTCATGGCTGCTATGCAGTCTGACCCTCTGCCTGAAGCAGTCCAT
GTGACTATTTTCATGGAGGGTCTCCGTGCTGGCGTTGCCAGAACCGAAGTCTTTCGGGTTCACCCCTCTAGATTTTAAGAGGCTGTGAGAATTGCTCTTA
ATGCTGAGCATAACTTCAAGTCGTCCAGACTTGGCTGGAATGGGTACAACCATAGCTCTGCGAGAGCAAACTACACGAGTACTCCGGCCGGTACTAGGCC
GGAACCGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGCTGCTGAGCAGCAACGTGTTTTACGACGTTGTTATACGTGCGGAAGC
ACTAAACAATTACGGTTGCCCTTTGCGTAAACAGCGCCAGGCTACGAGTCAACACTCTACCCCGAGCCAGAAGTCTGGCATGGCACGGGGAAATTCCAAC
ACCCAGTAGGCGTGGGGCGCCCTACTGGGGGAGAACTAAGTTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGGCTTAGACCCAAAGAGTTCCATACC
TACTGGTATGGAGCGTGGATACAAGGCTGGCTTGTTGGTCGCTGAGGTGAAAGTTAAAGGCTTTGAAAATCCTTGGTCGATTTTAATCGAGTCTGGAGCG
TCTTGCAATTATGTTCGACGTCGTTCCCTTGAGGGAAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATTCCATCACGGTTCGTTTAACAC
TGGAAGTCGTGTCACTGTACCTAAAGTTCCTTTGAACTTAGGTATAAAGTTCTTGGACTTTGATAGCATTGAACGCTGTCTTGTCCTTGATTTGGACTCG
AGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGAGCCATGGATTGATTGGAGGTCGAAGACCTTAGGCGCTACGCGCAATGTTCCTGGTA
AAGCTTTGGAGAGTCATGAACCTACCTTTGCTAAGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGTCAATGTGCTGGACATTGGAATGTC
TGAGTTAACTAACTCCAATGTTGAAACCATGAATCCGAGCGTAGCTCGTTGAATATTAGTGATACGGCACGTACTCCGTTGAGTGTTACTCGTTGTGATA
ACGAGTCACTGCATGCTGAAAGCATAGTTGGCCTAGAGCCGAGTTATTTAGAATGTGACTCTTTTGATGTGTGTGGGGTGACACGTGAAAATTCACCGAG
TGCAATCGGCCGTGAAGGCACCACACTTAATGTCGGTAATTACATCAGCTCTCGTATAGAGCATACTACTACTAGTAGCAACCACGGGAACACTATTGTC
CCGAACCCAGAGGGGTGTAAGGTCCCATCGAAGAGACGACCAGGACGCCAGGTGGCAACTGTTAAGCGCCAGGCGTCCGCGCAGTCACAGAGTGACAATA
GTGATACACTAAATATACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTTAGCCTGGAAACCCTGCCATCTTTGGATGCTCTTTGTGAGCTAGA
CGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCGACTTGGTGGTCATTAGACCCGATTTTGAGTTGAACTCGTCCTCATTG
ATGGATGAGTCGGTCCTAGAGGACATCAAGGCGGCACTCAGTTCCCGGAGTGGATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTATTCTTTGGTAA
AGGAATTTCAAGATGTGGTGTGTCACAACCCACCATCCGTCTTACCTCCCGATAGAGGTCTATGTCATGAAGTTGACCTAGTTCCAGGAACTAAATACTG
CGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCTCGCAGCAGGAATGGTGCGGGAGAGTAAGTAG
CCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGACGTATTGTGCACGCTTATAATAAGCTCAATGCTGCCACTATCCCGGCTCAGA
CACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGACGTACATTGAACAGTGCGCTCGACTTAGTCGATGGTTATTATCAGCTGCTCATGCG
AGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCTCCGGCTACTTTT
AACCGTCTGGTGACGAAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGAAATCTTTGTCCATAGTCGTGCAACGAACGGTCGATCTG
ATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATTCGCACGAATAAATTGTATGCAAATGCATTTAAGTGCATCTCTGGTGCAGAAGA
TATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCCATATCGATTGGCCGGTTCCAAAGAACCAAAAAT
ATCTACGTAAGTGGCTTTGCCTTGCCAATTACTTGCATAAGTATAGTGCAAATTACGCAGATATGGCTGGGCCATTATCCATCTCCTTAAGAAGGATGTG
GAGTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGGCCTTGCCCGATCCCGATCGGCCTT
TCAGTGTCTTCTGTGACGTATCTGACTTTGCCATAGGCAGTGCTCTGTCACAAACAGATGTCGATGGATGCGAATGCGTCATTGCATTCGAATCTCGACA
GCTCAAAGCTGCTGAAATGAACTATCAAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTCAAAG
CCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTTTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCCGAAT
ATAACTTCGAAATGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTC
ATCTTCATTCACTGAATTAATCGATGCGGCTTATGCCAAGGATGAACAATGTGTAGTTTTGCTACGTGCTCTTGGCAGCGAGGAGTTTAAAGCTCGGACA
TAGAATTTTTGGCACGCTTACGTGCGAGGCTACATCGATATTGTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGC
TTTCCCTCATGATGAGGAGTTGAAGTATCGAATACTCTATGAGGCACATGATACCGCTGTAAGTGGTCATCTCGGTCGTGAGAAGACCCATAGCTCCGTG
AGACAGGCTTATTGGTGGCCCAAACTATACAAATGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATTCGGCGG
AGCCGCTGGCTTGTCTGCCTGTACCAACTGGGTGTTGAGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACTGGCAT
TGTGGTCTTTGTTGACCAATTGAGCAAGATGGCTCACCTAGCGGCAGTGCCGGACTCCATTGATGCCGAAGGTAACAGCGAAGCTGTTTATCGACCGTGT
GTTACGACAACATGGTTTACCAGTGGCAATTGTCTCTGACAGAGATCCCCGCTTCGCTGGGAAGTTTTGGAAGTCCATCTTCAAAGTGCTCGGCACTCGT
TGGACATGTCCACAGCGGATCATCCGCAGACCAATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGTC
TATGCGTTGTAGCTCCATGCTCCCTGTATTCGAATTTGCGTTGAACAACGCTGTTCATGCCTCAACAGGCTACACTCCGTTCTACGTGAACGGTCTCACC
CACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGACGATAGGCTTGCTGATATCAGCCCTGATACTGTTCAAA
AACAGGTAGGCGAGTTTCTTGCAACGCGATTGAATGTCTTAAGACATGTGCGTAACGCAATGACTGAAAGCCAAGACCAACAAAAACAACAAGCAGATGC
TAAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTCAAGACA
AAGTTGCGTCCGCGCTTCATTGGACCATTCACGGCCGTTGCTAAGAAGGACTTGCGTATACGCTAAACCTTCCGCGCACATTGCGCACACATCCTGTGTT
CTACGTTGGCCTGCTTAAGCCGTATCGGGATCCT