Description :
From Genome Similarity Track
Location :
Scaffold_16:304985- 306632
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006766Similar to ABCA2: ATP-binding cassette sub-family A member 2 (Homo sapiens)

Sequence
1647 bases(100 bases per row)
TCAATCGCAGCGGCCAAGTTGTAACCGGTTGGGTGAGACGCCACGATACGGTCAGCTAACGAAGCGTTACCGAACGACTGACATTTTTCCTTCAGCTCCA
TCGGCGTCACGAATGCGTTGCTCCCGAAATGCTGGAGAATCAGATCTTGCTGCTCTTCCGGGGTCAAAGCTGCAAGCTTCACGTCAAACACGAGACCATC
GCCGAATCGACTCTTCAAGTGCTGCACGCTCCCCAAGCATCGCAAGCGACCACCGACCATGATGCCCACACGAGTACAGAGCGCTTCCGACTCTTCCATA
CTGTGTGTCGTCAGCACAATCGTTGATGCCTTGCTACGCGTAGAGATGTTCGCGATCACCTCCCACATGAAGCGACGAGATACCGGGTCCATACCAGTCG
ACGGCTCATCCAAGAAGATGATCTGAGGGTTCCCGATCATCGCAATCGCCACCGACAACTTGCGCTTGTTACCGCCACTCAAGCTGCCCGCGAGCTTGTG
TTCAAACGAGCTGAGGTTCAGTTGCTGGATTTTGTCCGACACGACATCGTTCAGATCTGCGGACGACACGCCCTTGATGCGAGCAAACAGCTCCAAATGC
TCACGGACAGTCAATAGTTCGAAGAGGGCGTCAAACTGTGGGCAGTACCCAATCTGGTGGCGCACTTCGATTTGTTGAGTCAAGATGTCGAACCCGCCAA
GTGTTGCAGTACCAGAAGTTGGAGCAATATCACCGGTGAGCATTTTCATCGTTGAGCTTTTGCCAGCGCCATTGATCCCCAAAAAGCCAAAGCATTCACC
GCGCTTCAAACCAAACGACAAGTTGTGAACAGCAACTTTTCCACCGTAGACCTTGCGCAAGTTCTTCAGTTTCACGACATCATAGTCCGCTGCACCAGAC
GCCACCAGATCTGCTTCATTTTGAACGTCCAGGTCTTGTTCAAATGACTCTGTTTTCGTTGGTTTGGCGCCGGATAGTAGATTCTTCACACGCGGAAATG
TCAACGCATAGTCAATGGCAACGGTCAAGGTAGCAAATGCGACTGCCGTCACCCCAAGGTATATCATTTCGTAGCCCATAATGTCCGTGCTGAACGGGCT
CTTTTTCTGCTTCGGTTCGAAAATCGTGAAGAGCTCATGAAGGACCAAATTCAGCAGGCCGTTCCCGAGGTTGAAAAGTGGTGACAACCGCCAAATGTAT
ACAAGCCAAGCATTGATGTCCTTCGTCGACTCGAGCACGCTCAAGATGAAGGATACCACCATCAACACGACTCCAATCGTAAAGTTGATGATCATAGTGT
GCATCTGAGATGACGCGTGTTCCTTGAACAGGTACGACAGGCAGTACGTAAATGGGCAAATCGCAATACCGAACAGGAAAAGTAGCACGATCACAGCTGG
GAATGTCGACGGAGTACAGCTCAAGCAATCACTGCTACCGGTCATGGCGGAAATATCGAATGCCTTGATGAGAATAATCGCAGCGACAAAGGGCACCGCG
TACATCATCAAATCCCACAAGTAGTTCGACAGCCAGAACGCACCGAGGGAGACACCCGAAACCAATTGCTGGTGCTTCGAGTTGTGCTCGGCTTGTTTCT
CCTTCACCAAGAACACCACAATCGAAGCCGGGAAGTACGTAAACGCG