Description :
From Genome Similarity Track
Location :
Scaffold_41:304985- 306405
Transcript NameFunction/comments
Phyin_T30-4PITG_15998Phospholipase A-2-activating protein%2C putative
Phyin_T30-4PITG_15999Putative uncharacterized protein

Sequence
1420 bases(100 bases per row)
TATTTAACAAACATTCTGGTGTGTGTCTTCAGCCCGGCTACAACACCTTCGAAACAACGAAAATCACCAAGCTCATGGCCACGTTGCGTCAGTTTAACGA
CAAGATGAAAGAATCCCAGGTTAGTTACGGTTGAATGCAGTGCTTCGTGGGAGTATACTGTAACACTTGAGCATATTGTACTGAGCTACCTTAGGCACCA
GAAGCTCTCATTGACTCGCAGCTCATCGCGCTTGACCAGATCGCGCACACCGTTCAAGACACTGCGTTCTTCCACTCTAGCACCTTCGCTGCTGCCGAGA
TCACAACGCTGAGGAGTGTGCTGGACAAGTGGCCTGCAAAGTACGCCTTCCCGACACTGGATCTTCTCCGACTAGTCCTGGTGCACCCTCAGGGTCCAGC
CGCCCTGGGTGAAGCTGGATTGGCCACACTTGTCACCCAGGTGTTGACCTTGGGATTGCAGCCAGGACCAACTGACGGTGACGATGCGATCCCAATGTCA
TCGCGGATGCTATCGCTGCGAGTGCTTGCAAACATGTTCTTGCATGACGCGGCTCGCAAGGCTATTCTGGCTCACAAGACGGTGGTGCTGAGCAAATTGC
CGTCGTTCCAGGCTTTCCACCACAAACTTGTGGCGCTTAGTCTATCGACCGTTCTCCTCAAGTAAGCTCTGCTCGCTTTGGGAAAAAAGACTAAGAGTCT
GACTTTATTGTTGGACTTCTCGTGTTTGTTTAGCTTCGCTCGCGCTCAAGTAGCAAATCCTGGAGCTCTGACGCCTGATGACCAGATTGTGGTGGTCTCA
TTGTCCGCCGATCTACTCAACGGCTCGTACACTGTCCAGGAGTTGGGCGACGACACGATCCTGCGGTCTCTCGTGACCATCGGCACTCTGGTACGCTTCA
TGTCTGTCGCATCATATAGAGTTTTGTCATAAACAGTCTGTCCAACTGCTGCAGGCGCTGACTGGCGACGCTAAAGCGAAAGAAGCGGCGGGTGTGCACA
TTGCCATCTTCTCAGCTGCAAAGGCAAGTGAAGCCACTTCGCAAGTGGTTCAGGATTGCCTGGCAGAGCTGCAACAAGTTCTCTGCTAAAGATTTTTGCA
AACGCAACAACATTTTGACTTATCAGTGAGGAATGTGTGTTGGTTGGGGAGTGTTTGTCATCTCCACAGAGTTTTGTTTTTACTTTCTCTCATGCAAAAG
TTAAATAACCCATCGAGTACACGGGTGGGGAGGGGGGGGGGCACCACATCGGTGGGGCGTGGGGCTGCAAGGCCTCTTCTTGCGTGGTTACGATAGATGC
AATAGACTGGCTGGTAGTCAACTCCACTGCTTGGAGCTGTTGCCGATTGTTTTTTGTGGTCTGTCCCTGGACGATGAAGCATGGGGACCGAGCTGGACGT
CGCACCTTTTTATGATGCTT