Description :
From Genome Similarity Track
Location :
Scaffold_3:3049325- 3053478
Sequence
4153 bases(100 bases per row)
CACGATCACGGCCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCAC
CGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACATTCAGCAGTCCAAACCCACTCGATGTCCTTCTTCAGGAGCTGG
GACAGCGGGCGTATCATGCCCGCATAGACCTTCACGTACTTGCACAAATACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACATTCGACGGTGTCG
GCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCGACGAGACACCCGAGCACGGGTATCTCGCTCGCCGCGAAGATACA
CTTCTTCAGGTTTGCGTAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTTCGGAGATGCACCTTGTGCATCTCAACATCGCTCATTCCGTCCGCAGCC
CGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCAAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCT
TCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATTAGGATCTGATAGAA
CCCATCGCGCAGATCAAGAGCACTGTAAATAGTGCTCCTGGTCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCA
TCGTTCAGCTTGTTGTACGCATGAACGATCCGCCAGCCGCCCTGTGGCTTCTTGATACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTT
GTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTTCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAATACTTCGTCCCCGGCAC
GAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGTTCCGCACGGATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATTTCGTAGTAGGGA
CTCGTCTTCAACGAGTCCCAGCTCCGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACT
GCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCA
GCTCATGACTGGAAGCGAAGTCAACTCCAACGCTTGCGTCGGAGGATTAGCGAGGGTCGTCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACG
TTCAACGTCTCGACGTCCGGCTTTTCAGCCTCCGTCTGTCCGGCAGACATTTCTTGTAGCGCCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCA
TGCGCCGTCTTCTTGCTTTGCGGAGCCCGGCTCCGCTTGGATCTTGACCTCGTCCAGGCCCAGCCGTAGACGGGTGTTCTTCTTCAGTACCGCCGGCGGG
TTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGATCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGAA
CGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCAGAGCCGACTCGCCATCTTCACCTCGACGCCATCTTCACCTCGACGCCTGTTATTGGCGGA
GCCCTCTATTACGGAGAGTGCGTCGGCTCCCTGAGCCGACGAATCGAATTCACCCAAGCCATCGACTCCCTGAGTCGACGGCGTTTCGTCACCTTGGCTC
TTATTATTGGCCAAAACTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTGTGGTCCGAGACT
CTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTAGCTGCTCTTGCGCGCA
TGTTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTTGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTACGTAGCGGCAACAGGG
CCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGATCGGATCATGCCGTGCAAGCCACGGCATGCCCAATA
CAATGTCAAAATTATCGTCCAGATCCAGGACGATAAAGGCCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTT
CACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTC
TTCGACGCGCCAGAATCTACCAAAGCACGAAGAGAGCTGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGC
AGCGAGAATGAATCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCACGCCTACTGG
CGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGA
CTCTACCACAACGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGGTCCAGCATTTGCAGCACTCGAGAGGTCCAGAACCCATGCCCGTCCTCACTAC
CGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTACAAGAGTAATTGTAGCTTCGAGAGTACTC
GGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCAGGATGT
TCGAGACCAAGTACCGTGCTCTTTGAGCCTAAGTATGGACATCATGCTTGCCCTGCTGAAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGG
TGGCTCAAATGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCAACGTCTTGCACGTCC
GCCAAGACATGACATGGCGAACGCAACCATCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGG
TTGCCCTCTCTTCCAACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCGGGGACGACACCGTGGTAGACGAAGCAGCATCACGCT
GCTCCCTCATGATGAATCCCAGAGCAACACCATGTTGCTCTGTCGGCGTTAGCGTACGCAGCCTCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAG
TCGCTGGAGAGCTTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATAGACACCTCCGTA
TTCATGGGAAAGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCC
TACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTAGTTGAGTTAAGTATACGAGAATACTTTAATCGAG
ATAAAGACTCCAAGTAGCGGATTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTCCTGACTTCCTCTGAATGTAATATTCTAAGATAGGAATC
TGCCAACGGCTGGTTGGCAGAATTCCAATGCTGTGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGCCTCTATGGACCA
CCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGT